National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2286R-2 
 Symbol ND75  Full Name NADH:ubiquinone reductase 75kD subunit precursor 
 CG No CG2286  Old CG No CG2286 
 Synonyms CG2286, ND75 
 Accession No (Link to NCBI) NM_078528.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hochmuth CE, Biteau B, Bohmann D, Jasper H.
Redox regulation by Keap1 and Nrf2 controls intestinal stem cell proliferation in Drosophila.
Cell Stem Cell (2011) 8(2) 188-99 [ PubMed ID = 21295275 ] [ RRC reference ]

Tan SWS, Lee QY, Wong BSE, Cai Y, Baeg GH.
Redox Homeostasis Plays Important Roles in the Maintenance of the Drosophila Testis Germline Stem Cells.
Stem Cell Reports (2017) 9(1) 342-354 [ PubMed ID = 28669604 ] [ RRC reference ]

Tan SWS, Yip GW, Suda T, Baeg GH.
Small Maf functions in the maintenance of germline stem cells in the Drosophila testis.
Redox Biol (2018) 15 125-134 [ PubMed ID = 29245136 ] [ RRC reference ]

Owusu-Ansah E, Banerjee U.
Reactive oxygen species prime Drosophila haematopoietic progenitors for differentiation.
Nature (2009) 461(7263) 537-41 [ PubMed ID = 19727075 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGACCGCTAGTCAAGACCATC 
 Primer Seq. 3'
aatctagaggtaccGCCTTAATGGCCTTGGCCACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGACCGCTAG TCAAGACCAT CATGACACGC TGCATCCACT GCACCCGCTG TGTGCGTTTC 
0061 GCCTCCGAGA TTGCCGGCGT TGATGACCTG GGCACCACTG GCCGTGGCAA CGACATGCAG 
0121 ATCGGCACCT ACGTGGAGAA GCTCTTCCTT ACCGAACTGT CCGGCAACGT GATCGACCTG 
0181 TGCCCCGTGG GAGCGCTGAC CAACAAGCCC TACAGTTTTG TGGCCCGTCC CTGGGAGATC 
0241 CGTAAGGTGA GCAGCATCGA TGTGCTGGAC GCCGTCGGCA GCAACATTGT CGTCAGCACC 
0301 CGCACCAATG AGGtGCTGCG CATCCTGCCC CGTGAGAACG AGGACGTCAA CGAGGAATGG 
0361 CTTGCTGACA AATCGCGCTT CGCCTGCGAC GGTCTGAAGC GCCAgCNCCT GGTGGCTCCC 
0421 ATGGTGCGCA TgNCCAACGG CGAACTACAG GCCGTAGAGT GGGAGGGTGC CCTCATCGCC 
0481 GNGgcCAAGG CCATTAANGC  
 in silico PCR Fragment
0001 GGACCGCTAG TCAAGACCAT CATGACACGC TGCATCCACT GCACCCGCTG TGTGCGTTTC 
0061 GCCTCCGAGA TTGCCGGCGT TGATGACCTG GGCACCACTG GCCGTGGCAA CGACATGCAG 
0121 ATCGGCACCT ACGTGGAGAA GCTCTTCCTT ACCGAACTGT CCGGCAACGT GATCGACCTG 
0181 TGCCCCGTGG GAGCGCTGAC CAACAAGCCC TACAGTTTTG TGGCCCGTCC CTGGGAGATC 
0241 CGTAAGGTGA GCAGCATCGA TGTGCTGGAC GCCGTCGGCA GCAACATTGT CGTCAGCACC 
0301 CGCACCAATG AGGTGCTGCG CATCCTGCCC CGTGAGAACG AGGACGTCAA CGAGGAATGG 
0361 CTTGCTGACA AATCGCGCTT CGCCTGCGAC GGTCTGAAGC GCCAGCGCCT GGTGGCTCCC 
0421 ATGGTGCGCA TGCCCAACGG CGAACTACAG GCCGTAGAGT GGGAGGGTGC CCTCATCGCC 
0481 GTGGCCAAGG CCATTAAGGC  
 Assemble Data

2286R-2.IR_full       1   GGACCGCTAGTCAAGACCATCATGACACGCTGCATCCACTGCACCCGCTGTGTGCGTTTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2286R-2.in silico     1   GGACCGCTAGTCAAGACCATCATGACACGCTGCATCCACTGCACCCGCTGTGTGCGTTTC 60


2286R-2.IR_full       61  GCCTCCGAGATTGCCGGCGTTGATGACCTGGGCACCACTGGCCGTGGCAACGACATGCAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2286R-2.in silico     61  GCCTCCGAGATTGCCGGCGTTGATGACCTGGGCACCACTGGCCGTGGCAACGACATGCAG 120


2286R-2.IR_full       121 ATCGGCACCTACGTGGAGAAGCTCTTCCTTACCGAACTGTCCGGCAACGTGATCGACCTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2286R-2.in silico     121 ATCGGCACCTACGTGGAGAAGCTCTTCCTTACCGAACTGTCCGGCAACGTGATCGACCTG 180


2286R-2.IR_full       181 TGCCCCGTGGGAGCGCTGACCAACAAGCCCTACAGTTTTGTGGCCCGTCCCTGGGAGATC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2286R-2.in silico     181 TGCCCCGTGGGAGCGCTGACCAACAAGCCCTACAGTTTTGTGGCCCGTCCCTGGGAGATC 240


2286R-2.IR_full       241 CGTAAGGTGAGCAGCATCGATGTGCTGGACGCCGTCGGCAGCAACATTGTCGTCAGCACC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2286R-2.in silico     241 CGTAAGGTGAGCAGCATCGATGTGCTGGACGCCGTCGGCAGCAACATTGTCGTCAGCACC 300


2286R-2.IR_full       301 CGCACCAATGAGGTGCTGCGCATCCTGCCCCGTGAGAACGAGGACGTCAACGAGGAATGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2286R-2.in silico     301 CGCACCAATGAGGTGCTGCGCATCCTGCCCCGTGAGAACGAGGACGTCAACGAGGAATGG 360


2286R-2.IR_full       361 CTTGCTGACAAATCGCGCTTCGCCTGCGACGGTCTGAAGCGCCAGCNCCTGGTGGCTCCC 420
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
2286R-2.in silico     361 CTTGCTGACAAATCGCGCTTCGCCTGCGACGGTCTGAAGCGCCAGCGCCTGGTGGCTCCC 420


2286R-2.IR_full       421 ATGGTGCGCATGNCCAACGGCGAACTACAGGCCGTAGAGTGGGAGGGTGCCCTCATCGCC 480
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
2286R-2.in silico     421 ATGGTGCGCATGCCCAACGGCGAACTACAGGCCGTAGAGTGGGAGGGTGCCCTCATCGCC 480


2286R-2.IR_full       481 GNGGCCAAGGCCATTAANGC 500
                          | ||||||||||||||| ||
2286R-2.in silico     481 GTGGCCAAGGCCATTAAGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167152.1  CG2286-RB, transcript variant B (ND75), mRNA 
100   482  NM_078528.1  CG2286-RA, transcript variant A (ND75), mRNA 
0   10  NM_143367.2  CG10011-RA (CG10011), mRNA 
0   NM_131946.3  CG12184-RA (CG12184), mRNA 
0   NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   NM_079311.2  CG5638-RA (Rh7), mRNA 
0   12  NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   12  NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   10  NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   NM_001014494.1  CG33509-RA (CG33509), mRNA 
0   NM_079188.1  CG1132-RA (fd64A), mRNA 
0   NM_134655.1  CG11620-RA (CG11620), mRNA 
0   NM_176232.1  CG15097-RB, transcript variant B (CG15097), mRNA 
0   NM_137533.3  CG15097-RA, transcript variant A (CG15097), mRNA 
0   NM_169966.1  CG31198-RA (CG31198), mRNA 
0   NM_136907.1  CG13169-RA (CG13169), mRNA 
0   NM_132437.1  CG15207-RA (CG15207), mRNA 
0   NM_137822.2  CG13506-RA (CG13506), mRNA 
0   NM_078726.2  CG4385-RB, transcript variant B (S), mRNA 
0   NM_135895.2  CG15269-RA (CG15269), mRNA 
0   NM_167618.1  CG32551-RA (CG32551), mRNA 
0   NM_141084.2  CG7162-RA (MED1), mRNA 
0   NM_141681.1  CG9475-RA, transcript variant A (Rpt3R), mRNA 
0   NM_169308.2  CG9475-RB, transcript variant B (Rpt3R), mRNA 
0   NM_168547.1  CG10738-RA, transcript variant A (CG10738), mRNA 
0   NM_140396.1  CG10738-RB, transcript variant B (CG10738), mRNA 
0   NM_132053.1  CG6041-RA (CG6041), mRNA 
0   NM_079917.2  CG18296-RA (axo), mRNA 
0   NM_143026.1  CG6879-RA (CG6879), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.