National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2275R-2 
 Symbol Jra  Full Name Jun-related antigen 
 CG No CG2275  Old CG No CG2275 
 Synonyms jun, Djun, AP-1, Jun, JRA, DJun, DJUN, D-jun, c-Jun, D-Jun, d-Jun, jra, d-jun, AP1, cJun, CG2275, dJRA, dJun, l(2R)IA109, dJUN, l(2)IA109, dm-Jun, dAP-1, d-JRA, dJra, V, l(2)46Ef, Jra, D-jun/Jra 
 Accession No (Link to NCBI) NM_057238.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Brock AR, Wang Y, Berger S, Renkawitz-Pohl R, Han VC, Wu Y, Galko MJ.
Transcriptional regulation of Profilin during wound closure in Drosophila larvae.
J. Cell. Sci. (2012) 125(Pt 23) 5667-76 [ PubMed ID = 22976306 ] [ RRC reference ]

Bangi E, Pitsouli C, Rahme LG, Cagan R, Apidianakis Y.
Immune response to bacteria induces dissemination of Ras-activated Drosophila hindgut cells.
EMBO Rep. (2012) 13(6) 569-76 [ PubMed ID = 22498775 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGCTGCTGCGAACTTAAGTATTCAGAATGCTGGCAGTTCCGGAGCAACTGCCATTCAGAT 60

                          |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     61  CATACCTAAAACCGAGCCCGTTGGAGAAGAAGGCCCCATGTCACTGGACTTTCAGTCGCC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAACCTGAACACATCCACCCCGAATCCTAACAAGCGTCCCGGCTCGCTGGATCTGAACAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CAAGAGTGCCAAGAACAAGCGCATCTTCGCACCACTGGTCATCAACTCACCGGATCTGTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATCCAAGACGGTAAACACACCCGATTTGGAGAAGATCCTGCTATCCAACAATCTGATGCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACACCGCAGCCGGGAAAGGTGTTCCCCACCAAGGCGGGGCCCGTCACCGTGGAGCAGTT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGACTTCGGCAGGGGATTCGAGGAGGCCTTACACAATCTTCACACTAACTCCCAGGCATT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCCGTCCGCCAATTCCGCCGCTAATTCCGCCGCCAATAACACAACTGCGGCAGCCATGAC 480

2275R-2.IR_full       481 AGCGGTGAACAATGGCATCA 500
                          |||||||||||||||||||| silico     481 AGCGGTGAACAATGGCATCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165739.1  CG2275-RB, transcript variant B (Jra), mRNA 
100   482  NM_057238.3  CG2275-RA, transcript variant A (Jra), mRNA 
0   NM_164672.2  CG9098-RB, transcript variant B (CG9098), mRNA 
0   NM_135135.3  CG9098-RA, transcript variant A (CG9098), mRNA 
0   NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_132369.1  CG2990-RA, transcript variant A (CG2990), mRNA 
0   NM_167214.1  CG2990-RB, transcript variant B (CG2990), mRNA 
0   NM_169700.2  CG31045-RA, transcript variant A (Mhcl), mRNA 
0   NM_001043250.1  CG31045-RG, transcript variant G (Mhcl), mRNA 
0   NM_001043251.1  CG31045-RF, transcript variant F (Mhcl), mRNA 
0   NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   NM_132772.2  CG5599-RA (CG5599), mRNA 
0   NM_136661.1  CG12928-RA (CG12928), mRNA 
0   NM_078989.2  CG12369-RA, transcript variant A (Lac), mRNA 
0   NM_165906.1  CG12369-RB, transcript variant B (Lac), mRNA 
0   NM_141334.1  CG10979-RA (CG10979), mRNA 
0   NM_143701.2  CG6698-RA (NtR), mRNA 
0   NM_141437.2  CG10098-RA (CG10098), mRNA 
0   NM_135938.2  CG4935-RA (CG4935), mRNA 
0   NM_078705.2  CG1685-RA (pen), mRNA 
0   NM_139675.2  CG7479-RA (Aats-leu), mRNA 
0   NM_001015386.1  CG40041-PB.3 (CG40041), mRNA 
0   NM_001015387.1  CG40042-PA.3 (CG40042), mRNA 
0   NM_144357.2  CG13475-RA (HGTX), mRNA 
0   NM_143153.2  CG4719-RA (tankyrase), mRNA 
0   NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
0   NM_143547.2  CG15539-RA, transcript variant A (CG15539), mRNA 
0   NM_001043311.1  CG15539-RB, transcript variant B (CG15539), mRNA 
0   NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0   NM_167328.2  CG17762-RA, transcript variant A (tomosyn), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.