National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2275R-1 
 Symbol Jra  Full Name Jun-related antigen 
 CG No CG2275  Old CG No CG2275 
 Synonyms jun, Djun, AP-1, Jun, JRA, DJun, DJUN, D-jun, c-Jun, D-Jun, d-Jun, jra, d-jun, AP1, cJun, CG2275, dJRA, dJun, l(2R)IA109, dJUN, l(2)IA109, dm-Jun, dAP-1, d-JRA, dJra, V, l(2)46Ef, Jra, D-jun/Jra 
 Accession No (Link to NCBI) NM_057238.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Zhu S, Chen R, Soba P, Jan YN.
JNK signaling coordinates with ecdysone signaling to promote dendrite pruning of Drosophila sensory neurons.
Development (2019) [ PubMed ID = 30936183 ] [ RRC reference ]

Buchon N, Broderick NA, Chakrabarti S, Lemaitre B.
Invasive and indigenous microbiota impact intestinal stem cell activity through multiple pathways in Drosophila.
Genes Dev. (2009) 23(19) 2333-44 [ PubMed ID = 19797770 ] [ RRC reference ]

Bangi E, Pitsouli C, Rahme LG, Cagan R, Apidianakis Y.
Immune response to bacteria induces dissemination of Ras-activated Drosophila hindgut cells.
EMBO Rep. (2012) 13(6) 569-76 [ PubMed ID = 22498775 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCTGCTGCGAACTTAAGTAT 
 Primer Seq. 3'
aatctagaggtaccTGATGCCATTGTTCACCGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCTGCTGCG AACTTAAGTA TTCAGAATGC TGGCAGTTCC GGAGCAACTG CCATTCAGAT 
0061 CATACCTAAA ACCGAGCCCG TTGGAGAAGA AGGCCCCATG TCGCTGGACT TTCAGTCGCC 
0121 GAACCTGAAC ACATCCACCC CGAATCCTAA CAAGCGTCCC GGCTCGCTGG ATCTGAACAG 
0181 CAAGAGTGCC AAGAACAAGC GCATCTTCGC ACCACTGGTC ATCAACTCAC CGGATCTGTC 
0241 ATCCAAGACG GTAAACACAC CCGATTTGGA GAAGATCCTG CTATCCAACA ATCTGATGCA 
0301 AACACCGCAG CCGGGAAAGG TGTTCCCCAC CAAGGCGGGG CCCGTCACCG TGGAGCAGTT 
0361 GGACTTCGGC AGGGGATTCG AGGAGGCCTT ACACAATCTT CACACTAACT CCCAGGCATT 
0421 TCCGTCCGCC AATTCCGCCG CTAATTCCGC CGCCAATAAC ACAACTGCGG CAGCCATGAC 
0481 AGCGGTGAAC AATGGCATCA  
 in silico PCR Fragment
0001 CGCTGCTGCG AACTTAAGTA TTCAGAATGC TGGCAGTTCC GGAGCAACTG CCATTCAGAT 
0061 CATACCTAAA ACCGAGCCCG TTGGAGAAGA AGGCCCCATG TCACTGGACT TTCAGTCGCC 
0121 GAACCTGAAC ACATCCACCC CGAATCCTAA CAAGCGTCCC GGCTCGCTGG ATCTGAACAG 
0181 CAAGAGTGCC AAGAACAAGC GCATCTTCGC ACCACTGGTC ATCAACTCAC CGGATCTGTC 
0241 ATCCAAGACG GTAAACACAC CCGATTTGGA GAAGATCCTG CTATCCAACA ATCTGATGCA 
0301 AACACCGCAG CCGGGAAAGG TGTTCCCCAC CAAGGCGGGG CCCGTCACCG TGGAGCAGTT 
0361 GGACTTCGGC AGGGGATTCG AGGAGGCCTT ACACAATCTT CACACTAACT CCCAGGCATT 
0421 TCCGTCCGCC AATTCCGCCG CTAATTCCGC CGCCAATAAC ACAACTGCGG CAGCCATGAC 
0481 AGCGGTGAAC AATGGCATCA  
 Assemble Data

2275R-1.IR_full       1   CGCTGCTGCGAACTTAAGTATTCAGAATGCTGGCAGTTCCGGAGCAACTGCCATTCAGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2275R-1.in silico     1   CGCTGCTGCGAACTTAAGTATTCAGAATGCTGGCAGTTCCGGAGCAACTGCCATTCAGAT 60


2275R-1.IR_full       61  CATACCTAAAACCGAGCCCGTTGGAGAAGAAGGCCCCATGTCGCTGGACTTTCAGTCGCC 120
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
2275R-1.in silico     61  CATACCTAAAACCGAGCCCGTTGGAGAAGAAGGCCCCATGTCACTGGACTTTCAGTCGCC 120


2275R-1.IR_full       121 GAACCTGAACACATCCACCCCGAATCCTAACAAGCGTCCCGGCTCGCTGGATCTGAACAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2275R-1.in silico     121 GAACCTGAACACATCCACCCCGAATCCTAACAAGCGTCCCGGCTCGCTGGATCTGAACAG 180


2275R-1.IR_full       181 CAAGAGTGCCAAGAACAAGCGCATCTTCGCACCACTGGTCATCAACTCACCGGATCTGTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2275R-1.in silico     181 CAAGAGTGCCAAGAACAAGCGCATCTTCGCACCACTGGTCATCAACTCACCGGATCTGTC 240


2275R-1.IR_full       241 ATCCAAGACGGTAAACACACCCGATTTGGAGAAGATCCTGCTATCCAACAATCTGATGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2275R-1.in silico     241 ATCCAAGACGGTAAACACACCCGATTTGGAGAAGATCCTGCTATCCAACAATCTGATGCA 300


2275R-1.IR_full       301 AACACCGCAGCCGGGAAAGGTGTTCCCCACCAAGGCGGGGCCCGTCACCGTGGAGCAGTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2275R-1.in silico     301 AACACCGCAGCCGGGAAAGGTGTTCCCCACCAAGGCGGGGCCCGTCACCGTGGAGCAGTT 360


2275R-1.IR_full       361 GGACTTCGGCAGGGGATTCGAGGAGGCCTTACACAATCTTCACACTAACTCCCAGGCATT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2275R-1.in silico     361 GGACTTCGGCAGGGGATTCGAGGAGGCCTTACACAATCTTCACACTAACTCCCAGGCATT 420


2275R-1.IR_full       421 TCCGTCCGCCAATTCCGCCGCTAATTCCGCCGCCAATAACACAACTGCGGCAGCCATGAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2275R-1.in silico     421 TCCGTCCGCCAATTCCGCCGCTAATTCCGCCGCCAATAACACAACTGCGGCAGCCATGAC 480


2275R-1.IR_full       481 AGCGGTGAACAATGGCATCA 500
                          ||||||||||||||||||||
2275R-1.in silico     481 AGCGGTGAACAATGGCATCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165739.1  CG2275-RB, transcript variant B (Jra), mRNA 
100   482  NM_057238.3  CG2275-RA, transcript variant A (Jra), mRNA 
0   NM_164672.2  CG9098-RB, transcript variant B (CG9098), mRNA 
0   NM_135135.3  CG9098-RA, transcript variant A (CG9098), mRNA 
0   NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_132369.1  CG2990-RA, transcript variant A (CG2990), mRNA 
0   NM_167214.1  CG2990-RB, transcript variant B (CG2990), mRNA 
0   NM_169700.2  CG31045-RA, transcript variant A (Mhcl), mRNA 
0   NM_001043250.1  CG31045-RG, transcript variant G (Mhcl), mRNA 
0   NM_001043251.1  CG31045-RF, transcript variant F (Mhcl), mRNA 
0   NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   NM_132772.2  CG5599-RA (CG5599), mRNA 
0   NM_136661.1  CG12928-RA (CG12928), mRNA 
0   NM_078989.2  CG12369-RA, transcript variant A (Lac), mRNA 
0   NM_165906.1  CG12369-RB, transcript variant B (Lac), mRNA 
0   NM_141334.1  CG10979-RA (CG10979), mRNA 
0   NM_143701.2  CG6698-RA (NtR), mRNA 
0   NM_141437.2  CG10098-RA (CG10098), mRNA 
0   NM_135938.2  CG4935-RA (CG4935), mRNA 
0   NM_078705.2  CG1685-RA (pen), mRNA 
0   NM_139675.2  CG7479-RA (Aats-leu), mRNA 
0   NM_001015386.1  CG40041-PB.3 (CG40041), mRNA 
0   NM_001015387.1  CG40042-PA.3 (CG40042), mRNA 
0   NM_144357.2  CG13475-RA (HGTX), mRNA 
0   NM_143153.2  CG4719-RA (tankyrase), mRNA 
0   NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
0   NM_143547.2  CG15539-RA, transcript variant A (CG15539), mRNA 
0   NM_001043311.1  CG15539-RB, transcript variant B (CG15539), mRNA 
0   NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0   NM_167328.2  CG17762-RA, transcript variant A (tomosyn), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.