National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2272R-1 
 Symbol slpr  Full Name slipper 
 CG No CG2272  Old CG No CG2272 
 Synonyms dMLK, MLK2, Mlk2, dMLK2, CG2272, slpr, Mixed lineage protein kinase 2, slipper, Slpr 
 Accession No (Link to NCBI) NM_132230.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Neisch AL, Speck O, Stronach B, Fehon RG.
Rho1 regulates apoptosis via activation of the JNK signaling pathway at the plasma membrane.
J. Cell Biol. (2010) 189(2) 311-23 [ PubMed ID = 20404112 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGTGGACCGCGCTGTATGAC 
 Primer Seq. 3'
aatctagaggtaccTTGAGACTTCCTCCCCTGGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGTGGACCG CGCTGTATGA CTACGATGCC CAGGGCGAGG ATGAGCTGAC ACTGCGACGC 
0061 GGCGAAATCG TTGTGGTCCT GTCCACGGAC AGCGAGGTGT CTGGCGATGT GGGCTGGTGG 
0121 ACCGGCAAGA TTGGAGATAA GGTCGGTGTC TTTCCCAAGG ACTTTGTCAC CGATGAGGAC 
0181 CCACTGCAAC TGAATGTCTC GTCCGCCATT GGCGACNATC CAGCCGCATG AGATCGAATA 
0241 CAATGAGCTG GACATCAAGG AAGTTATCGG CTCCGGTGGC TTCTGCAAGG TCCATCGTGG 
0301 CTACTACGAT GGCGANGGAG GTGGCTATTA AGATTGCCCA TCAAACGGGC GAGGATGATA 
0361 TGCAGAGGAT GCNGGGACAA TGTCCTGCAG GAGNGCCAAA CTGTTTTNGG GCCCTCAAGC 
0421 ACGAAAATAT AGCAGCCCTG CGAGGAGTAT GTCTGAATAC CAAACTCTGT CTGGTGATGG 
0481 AGTATGCCAG GGGAGGAAGT CTCAA 
 in silico PCR Fragment
0001 CTGTGGACCG CGCTGTATGA CTACGATGCC CAGGGCGAGG ATGAGCTGAC ACTGCGACGC 
0061 GGCGAAATCG TTGTGGTCCT GTCCACGGAC AGCGAGGTGT CTGGCGATGT GGGCTGGTGG 
0121 ACCGGCAAGA TTGGAGATAA GGTCGGTGTC TTTCCCAAGG ACTTTGTCAC CGATGAGGAC 
0181 CCACTGCAAC TGAATGTCTC GTCCGCCATT GGCGAC-ATC CAGCCGCATG AGATCGAATA 
0241 CAATGAGCTG GACATCAAGG AAGTTATCGG CTCCGGTGGC TTCTGCAAGG TCCATCGTGG 
0301 CTACTACGAT GGCGA-GGAG GTGGCTATTA AGATTGCCCA TCAAACGGGC GAGGATGATA 
0361 TGCAGAGGAT GC-GGGACAA TGTCCTGCAG GAG-GCCAAA CTGTTTT-GG GCCCTCAAGC 
0421 ACGAAAATAT AGCAGCCCTG CGAGGAGTAT GTCTGAATAC CAAACTCTGT CTGGTGATGG 
0481 AGTATGCCAG GGGAGGAAGT CTCAA 
 Assemble Data

2272R-1.IR_full       1   CTGTGGACCGCGCTGTATGACTACGATGCCCAGGGCGAGGATGAGCTGACACTGCGACGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2272R-1.in silico     1   CTGTGGACCGCGCTGTATGACTACGATGCCCAGGGCGAGGATGAGCTGACACTGCGACGC 60


2272R-1.IR_full       61  GGCGAAATCGTTGTGGTCCTGTCCACGGACAGCGAGGTGTCTGGCGATGTGGGCTGGTGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2272R-1.in silico     61  GGCGAAATCGTTGTGGTCCTGTCCACGGACAGCGAGGTGTCTGGCGATGTGGGCTGGTGG 120


2272R-1.IR_full       121 ACCGGCAAGATTGGAGATAAGGTCGGTGTCTTTCCCAAGGACTTTGTCACCGATGAGGAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2272R-1.in silico     121 ACCGGCAAGATTGGAGATAAGGTCGGTGTCTTTCCCAAGGACTTTGTCACCGATGAGGAC 180


2272R-1.IR_full       181 CCACTGCAACTGAATGTCTCGTCCGCCATTGGCGACNATCCAGCCGCATGAGATCGAATA 240
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
2272R-1.in silico     181 CCACTGCAACTGAATGTCTCGTCCGCCATTGGCGAC-ATCCAGCCGCATGAGATCGAATA 240


2272R-1.IR_full       241 CAATGAGCTGGACATCAAGGAAGTTATCGGCTCCGGTGGCTTCTGCAAGGTCCATCGTGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2272R-1.in silico     241 CAATGAGCTGGACATCAAGGAAGTTATCGGCTCCGGTGGCTTCTGCAAGGTCCATCGTGG 300


2272R-1.IR_full       301 CTACTACGATGGCGANGGAGGTGGCTATTAAGATTGCCCATCAAACGGGCGAGGATGATA 360
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
2272R-1.in silico     301 CTACTACGATGGCGA-GGAGGTGGCTATTAAGATTGCCCATCAAACGGGCGAGGATGATA 360


2272R-1.IR_full       361 TGCAGAGGATGCNGGGACAATGTCCTGCAGGAGNGCCAAACTGTTTTNGGGCCCTCAAGC 420
                          |||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||
2272R-1.in silico     361 TGCAGAGGATGC-GGGACAATGTCCTGCAGGAG-GCCAAACTGTTTT-GGGCCCTCAAGC 420


2272R-1.IR_full       421 ACGAAAATATAGCAGCCCTGCGAGGAGTATGTCTGAATACCAAACTCTGTCTGGTGATGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2272R-1.in silico     421 ACGAAAATATAGCAGCCCTGCGAGGAGTATGTCTGAATACCAAACTCTGTCTGGTGATGG 480


2272R-1.IR_full       481 AGTATGCCAGGGGAGGAAGTCTCAA 505
                          |||||||||||||||||||||||||
2272R-1.in silico     481 AGTATGCCAGGGGAGGAAGTCTCAA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132230.2  CG2272-RA (slpr), mRNA 
0.2   NM_143605.2  CG11339-RA (CG11339), mRNA 
0   NM_140866.1  CG9299-RA (CG9299), mRNA 
0   NM_132019.1  CG4096-RA (CG4096), mRNA 
0   NM_206251.2  CG16973-RD, transcript variant D (msn), mRNA 
0   NM_206249.2  CG16973-RE, transcript variant E (msn), mRNA 
0   NM_206252.2  CG16973-RB, transcript variant B (msn), mRNA 
0   NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0   NM_206250.2  CG16973-RC, transcript variant C (msn), mRNA 
0   NM_137846.2  CG17807-RA (CG17807), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_164554.2  CG2822-RB, transcript variant B (Shaw), mRNA 
0   NM_057373.2  CG2822-RA, transcript variant A (Shaw), mRNA 
0   NM_130577.2  CG3095-RA (hfw), mRNA 
0   NM_057425.2  CG9450-RA (tud), mRNA 
0   NM_080148.2  CG2522-RA (Gtp-bp), mRNA 
0   NM_137339.2  CG9646-RA (CG9646), mRNA 
0   10  NM_140033.1  CG4684-RA (nwk), mRNA 
0   NM_079863.2  CG2048-RC, transcript variant C (dco), mRNA 
0   NM_170535.1  CG2048-RA, transcript variant A (dco), mRNA 
0   NM_170536.2  CG2048-RB, transcript variant B (dco), mRNA 
0   NM_079902.2  CG6741-RB, transcript variant B (a), mRNA 
0   NM_166514.1  CG6741-RA, transcript variant A (a), mRNA 
0   NM_001014543.1  CG6741-RC, transcript variant C (a), mRNA 
0   NM_143759.2  CG6760-RA (l(3)70Da), mRNA 
0   13  NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_141809.1  CG6715-RA (KP78a), mRNA 
0   NM_132051.1  CG3726-RA (CG3726), mRNA 
0   NM_078500.3  CG4317-RA (Mipp2), mRNA 
0   NM_138264.1  CG9173-RA (CG9173), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.