National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2262R-1 
 Symbol Smox  Full Name Smad on X 
 CG No CG2262  Old CG No CG2262 
 Synonyms dSmad2, SMAD2, smox, dSMAD2, DSMAD2, smad2, Smad2, Sad, ted, sad, l(1)G0348, tmp, CG2262, Smox, DSmad2 
 Accession No (Link to NCBI) NM_078524.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Zhu S, Chen R, Soba P, Jan YN.
JNK signaling coordinates with ecdysone signaling to promote dendrite pruning of Drosophila sensory neurons.
Development (2019) [ PubMed ID = 30936183 ] [ RRC reference ]

Hevia CF, López-Varea A, Esteban N, de Celis JF.
A Search for Genes Mediating the Growth-Promoting Function of TGFβ in the Drosophila melanogaster Wing Disc.
Genetics (2017) 206(1) 231-249 [ PubMed ID = 28315837 ] [ RRC reference ]

Hevia CF, de Celis JF.
Activation and function of TGFβ signalling during Drosophila wing development and its interactions with the BMP pathway.
Dev. Biol. (2013) 377(1) 138-53 [ PubMed ID = 23485686 ] [ RRC reference ]

Eusebio N, Tavares L, Pereira PS.
CtBP represses Dpp-dependent Mad activation during Drosophila eye development.
Dev. Biol. (2018) 442(1) 188-198 [ PubMed ID = 30031756 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGTCAGAGAAGGCCGTCAAG 
 Primer Seq. 3'
aatctagaggtaccCTGGCAGACGATGATACGGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGTCAGAGA AGGCCGTCAA GAATCTGGTC AAGAAGATCA AGAAGAATTC GCAGCTGGAG 
0061 GAGCTAGAGC GCGCGATCTC CACACAGAAC TGCCAAGACG CGGTGCGTTG ACGGTGCCGC 
0121 GCAGCAAGCC AGCTCCCGCC GGCGAGCATC TGCGCAAGGG TCTGCCGCAC GTCATCCTAT 
0181 TGCCGCCTGT GGCGCTGGCC CGATCTCCAG AGTCAGAATG AACTAAAGCC CCTCGATCAT 
0241 TGCGAGTACG CCTTCCATTT GCGCAAGGAG GAGATCTGCA TAAATCCGTA CCACTACAAA 
0301 AAAATTGAAC TGTCCATCCT GGTGCCCAAA TCGCTGCCCA CGCCGCCCGA CTCCATTGTG 
0361 GACTATCCGC TGGACAACCA TACGCACCAG ATACCCAACA ACACCGATTA CAATGCGGCG 
0421 ATCATTCGCA GCGCCTCGTT GAGTCCGCCG CAGTACATGG AATTGGGCGG TGCCGGGCCC 
0481 GTTTCCGTAT CATCGTCTGC CAG 
 in silico PCR Fragment
0001 TGGTCAGAGA AGGCCGTCAA GAATCTGGTC AAGAAGATCA AGAAGAATTC GCAGCTGGAG 
0061 GAGCTAGAGC GCGCGATCTC CACACAGAAC TGCC-AGACG CGGTGCG-TG ACGGTGCCGC 
0121 GCAGCAAGCC AGCTCCCGCC GGCGAGCATC TGCGCAAGGG TCTGCCGCAC GTCAT-CTAT 
0181 TGCCGCCTGT GGCGCTGGCC CGATCTCCAG AGTCAGAATG AACTAAAGCC CCTCGATCAT 
0241 TGCGAGTACG CCTTCCATTT GCGCAAGGAG GAGATCTGCA TAAATCCGTA CCACTACAAA 
0301 AAAATTGAAC TGTCCATCCT GGTGCCCAAA TCGCTGCCCA CGCCGCCCGA CTCCATTGTG 
0361 GACTATCCGC TGGACAACCA TACGCACCAG ATACCCAACA ACACCGATTA CAATGCGGCG 
0421 ATCATTCGCA GCGCCTCGTT GAGTCCGCCG CAGTACATGG AATTGGGCGG TGCCGGGCCC 
0481 GTTTCCGTAT CATCGTCTGC CAG 
 Assemble Data

2262R-1.IR_full       1   TGGTCAGAGAAGGCCGTCAAGAATCTGGTCAAGAAGATCAAGAAGAATTCGCAGCTGGAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2262R-1.in silico     1   TGGTCAGAGAAGGCCGTCAAGAATCTGGTCAAGAAGATCAAGAAGAATTCGCAGCTGGAG 60


2262R-1.IR_full       61  GAGCTAGAGCGCGCGATCTCCACACAGAACTGCCAAGACGCGGTGCGTTGACGGTGCCGC 120
                          |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||
2262R-1.in silico     61  GAGCTAGAGCGCGCGATCTCCACACAGAACTGCC-AGACGCGGTGCG-TGACGGTGCCGC 120


2262R-1.IR_full       121 GCAGCAAGCCAGCTCCCGCCGGCGAGCATCTGCGCAAGGGTCTGCCGCACGTCATCCTAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
2262R-1.in silico     121 GCAGCAAGCCAGCTCCCGCCGGCGAGCATCTGCGCAAGGGTCTGCCGCACGTCAT-CTAT 180


2262R-1.IR_full       181 TGCCGCCTGTGGCGCTGGCCCGATCTCCAGAGTCAGAATGAACTAAAGCCCCTCGATCAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2262R-1.in silico     181 TGCCGCCTGTGGCGCTGGCCCGATCTCCAGAGTCAGAATGAACTAAAGCCCCTCGATCAT 240


2262R-1.IR_full       241 TGCGAGTACGCCTTCCATTTGCGCAAGGAGGAGATCTGCATAAATCCGTACCACTACAAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2262R-1.in silico     241 TGCGAGTACGCCTTCCATTTGCGCAAGGAGGAGATCTGCATAAATCCGTACCACTACAAA 300


2262R-1.IR_full       301 AAAATTGAACTGTCCATCCTGGTGCCCAAATCGCTGCCCACGCCGCCCGACTCCATTGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2262R-1.in silico     301 AAAATTGAACTGTCCATCCTGGTGCCCAAATCGCTGCCCACGCCGCCCGACTCCATTGTG 360


2262R-1.IR_full       361 GACTATCCGCTGGACAACCATACGCACCAGATACCCAACAACACCGATTACAATGCGGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2262R-1.in silico     361 GACTATCCGCTGGACAACCATACGCACCAGATACCCAACAACACCGATTACAATGCGGCG 420


2262R-1.IR_full       421 ATCATTCGCAGCGCCTCGTTGAGTCCGCCGCAGTACATGGAATTGGGCGGTGCCGGGCCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2262R-1.in silico     421 ATCATTCGCAGCGCCTCGTTGAGTCCGCCGCAGTACATGGAATTGGGCGGTGCCGGGCCC 480


2262R-1.IR_full       481 GTTTCCGTATCATCGTCTGCCAG 503
                          |||||||||||||||||||||||
2262R-1.in silico     481 GTTTCCGTATCATCGTCTGCCAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078524.2  CG2262-RA (Smox), mRNA 
0   NM_079175.2  CG1242-RA (Hsp83), mRNA 
0   26  46  NM_057669.2  CG12399-RA (Mad), mRNA 
0   NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_167754.1  CG1417-RC, transcript variant C (slgA), mRNA 
0   NM_206803.1  CG1417-RH, transcript variant H (slgA), mRNA 
0   NM_078709.2  CG1417-RE, transcript variant E (slgA), mRNA 
0   NM_167751.1  CG1417-RA, transcript variant A (slgA), mRNA 
0   NM_206804.1  CG1417-RG, transcript variant G (slgA), mRNA 
0   NM_206805.1  CG1417-RF, transcript variant F (slgA), mRNA 
0   NM_167753.1  CG1417-RB, transcript variant B (slgA), mRNA 
0   NM_167752.1  CG1417-RD, transcript variant D (slgA), mRNA 
0   NM_140952.1  CG5585-RA (CG5585), mRNA 
0   NM_136640.2  CG8801-RA (CG8801), mRNA 
0   NM_057412.3  CG10223-RA (Top2), mRNA 
0   NM_169257.1  CG11988-RB, transcript variant B (neur), mRNA 
0   NM_057304.3  CG11988-RA, transcript variant A (neur), mRNA 
0   NM_167847.1  CG18214-RC, transcript variant C (trio), mRNA 
0   NM_143703.2  CG18214-RA, transcript variant A (trio), mRNA 
0   NM_144382.2  CG3021-RA (CG3021), mRNA 
0   NM_167007.1  CG2982-RA, transcript variant A (CG2982), mRNA 
0   NM_131932.2  CG2982-RB, transcript variant B (CG2982), mRNA 
0   NM_132968.1  CG5010-RA (CG5010), mRNA 
0   NM_137155.2  CG10228-RA (Pcf11), mRNA 
0   NM_165685.1  CG30338-RA (CG30338), mRNA 
0   NM_078671.3  CG7098-RA (dik), mRNA 
0   NM_142834.2  CG6985-RA (CG6985), mRNA 
0   NM_078908.2  CG12845-RA (Tsp42Ef), mRNA 
0   NM_057378.2  CG4200-RA (sl), mRNA 
0   NM_141694.1  CG8516-RA (CG8516), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.