National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2248R-1 
 Symbol Rac1  Full Name Rac1 
 CG No CG2248  Old CG No CG2248 
 Synonyms Drac, rac1, DmRAC1, Rac, Drac1, GTPase Rac1, DRac1, Rac GTPase, rac, dRac1, D-Rac 1, Dm Rac1, dRac, DracA, DRac, RacA, D-Rac, D-Rac1, DRacA, Drac1a, Dmrac1, CG2248, Rac1 
 Accession No (Link to NCBI) NM_057602.3 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ma X, Xu W, Zhang D, Yang Y, Li W, Xue L.
Wallenda regulates JNK-mediated cell death in Drosophila.
Cell Death Dis (2015) 6 e1737 [ PubMed ID = 25950467 ] [ RRC reference ]

Xavier MJ, Williams MJ.
The Rho-family GTPase Rac1 regulates integrin localization in Drosophila immunosurveillance cells.
PLoS ONE (2011) 6(5) e19504 [ PubMed ID = 21603603 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAGGCGATCAAGTGCGTCGT 
 Primer Seq. 3'
aatctagaggtaccCGGTTTTCAGACCCTTCTGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCAGGCGATC AAGTGCGTCG TCGTGGGCGA CGGAGCCGTG GGAAAGACCT GCCTGCTGAT 
0061 CAGCTACACG ACCAATGCCT TTCCCGGCGA GTACATACCC ACCGTGTTCG ACAACTACTC 
0121 GGCCAACGTG ATGGTGGACN GCCAAGCCCA TCAACCTGGG CCTGTGGGAT ACGGCCGGGC 
0181 AGGNAGGACT ACGACCGACT GAGGCCACTG TCTTATCCCC AGACCGATGT CTTCCTCATC 
0241 TGCTTCTCGC TGGTGAATCC GGCATCGTTC GAGAACGTGC GGGCCAAGTG GTATCCGGAG 
0301 GTGCGCCACC ACTGCCCCAG CACGCCCATC ATCCTGGTGG GCACCAAGCT GGATTTGCGC 
0361 GACGACAAGA ACACAATCGA AAAGCTGAGG GACAAGAAAC TGGCGCCCAT CACCTATCCG 
0421 CAGGGCCTgG CCATGGCCAA GGAAATCGGA GCGGTCAAGT ATCTGGAGTG CTCGGCCCTG 
0481 ACGCAGAAGG GTCTGAAAAC CG 
 in silico PCR Fragment
0001 GCAGGCGATC AAGTGCGTCG TCGTGGGCGA CGGAGCCGTG GGAAAGACCT GCCTGCTGAT 
0061 CAGCTACACG ACCAATGCCT TTCCCGGCGA GTACATACCC ACCGTGTTCG ACAACTACTC 
0121 GGCCAACGTG ATGGTGGAC- GCCAAGCCCA TCAACCTGGG CCTGTGGGAT ACGGCCGGGC 
0181 AGG-AGGACT ACGACCGACT GAGGCCACTG TCTTATCCCC AGACCGATGT CTTCCTCATC 
0241 TGCTTCTCGC TGGTGAATCC GGCATCGTTC GAGAACGTGC GGGCCAAGTG GTATCCGGAG 
0301 GTGCGCCACC ACTGCCCCAG CACGCCCATC ATCCTGGTGG GCACCAAGCT GGATTTGCGC 
0361 GACGACAAGA ACACAATCGA AAAGCTGAGG GACAAGAAAC TGGCGCCCAT CACCTATCCG 
0421 CAGGGCCTGG CCATGGCCAA GGAAATCGGA GCGGTCAAGT ATCTGGAGTG CTCGGCCCTG 
0481 ACGCAGAAGG GTCTGAAAAC CG 
 Assemble Data

2248R-1.IR_full       1   GCAGGCGATCAAGTGCGTCGTCGTGGGCGACGGAGCCGTGGGAAAGACCTGCCTGCTGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2248R-1.in silico     1   GCAGGCGATCAAGTGCGTCGTCGTGGGCGACGGAGCCGTGGGAAAGACCTGCCTGCTGAT 60


2248R-1.IR_full       61  CAGCTACACGACCAATGCCTTTCCCGGCGAGTACATACCCACCGTGTTCGACAACTACTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2248R-1.in silico     61  CAGCTACACGACCAATGCCTTTCCCGGCGAGTACATACCCACCGTGTTCGACAACTACTC 120


2248R-1.IR_full       121 GGCCAACGTGATGGTGGACNGCCAAGCCCATCAACCTGGGCCTGTGGGATACGGCCGGGC 180
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
2248R-1.in silico     121 GGCCAACGTGATGGTGGAC-GCCAAGCCCATCAACCTGGGCCTGTGGGATACGGCCGGGC 180


2248R-1.IR_full       181 AGGNAGGACTACGACCGACTGAGGCCACTGTCTTATCCCCAGACCGATGTCTTCCTCATC 240
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2248R-1.in silico     181 AGG-AGGACTACGACCGACTGAGGCCACTGTCTTATCCCCAGACCGATGTCTTCCTCATC 240


2248R-1.IR_full       241 TGCTTCTCGCTGGTGAATCCGGCATCGTTCGAGAACGTGCGGGCCAAGTGGTATCCGGAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2248R-1.in silico     241 TGCTTCTCGCTGGTGAATCCGGCATCGTTCGAGAACGTGCGGGCCAAGTGGTATCCGGAG 300


2248R-1.IR_full       301 GTGCGCCACCACTGCCCCAGCACGCCCATCATCCTGGTGGGCACCAAGCTGGATTTGCGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2248R-1.in silico     301 GTGCGCCACCACTGCCCCAGCACGCCCATCATCCTGGTGGGCACCAAGCTGGATTTGCGC 360


2248R-1.IR_full       361 GACGACAAGAACACAATCGAAAAGCTGAGGGACAAGAAACTGGCGCCCATCACCTATCCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2248R-1.in silico     361 GACGACAAGAACACAATCGAAAAGCTGAGGGACAAGAAACTGGCGCCCATCACCTATCCG 420


2248R-1.IR_full       421 CAGGGCCTGGCCATGGCCAAGGAAATCGGAGCGGTCAAGTATCTGGAGTGCTCGGCCCTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2248R-1.in silico     421 CAGGGCCTGGCCATGGCCAAGGAAATCGGAGCGGTCAAGTATCTGGAGTGCTCGGCCCTG 480


2248R-1.IR_full       481 ACGCAGAAGGGTCTGAAAACCG 502
                          ||||||||||||||||||||||
2248R-1.in silico     481 ACGCAGAAGGGTCTGAAAACCG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057602.3  CG2248-RA (Rac1), mRNA 
3.73   18  83  145  121  NM_139864.1  CG8556-RA (Rac2), mRNA 
2.9   14  NM_166139.2  CG8416-RD, transcript variant D (Rho1), mRNA 
2.9   14  NM_206127.1  CG8416-RG, transcript variant G (Rho1), mRNA 
2.9   14  NM_206129.1  CG8416-RE, transcript variant E (Rho1), mRNA 
2.9   14  NM_134309.1  CG8416-RC, transcript variant C (Rho1), mRNA 
2.9   14  NM_057750.3  CG8416-RA, transcript variant A (Rho1), mRNA 
2.9   14  NM_206128.1  CG8416-RF, transcript variant F (Rho1), mRNA 
2.9   14  NM_134308.2  CG8416-RB, transcript variant B (Rho1), mRNA 
0.41   16  NM_001042801.1  CG34104-RB, transcript variant B (CG34104), mRNA 
0.41   16  NM_001042802.1  CG34104-RA, transcript variant A (CG34104), mRNA 
0   21  68  65  NM_167677.1  CG12530-RB, transcript variant B (Cdc42), mRNA 
0   21  68  65  NM_078690.2  CG12530-RA, transcript variant A (Cdc42), mRNA 
0   11  43  34  NM_170344.1  CG5588-RC, transcript variant C (Mtl), mRNA 
0   11  43  34  NM_079809.2  CG5588-RB, transcript variant B (Mtl), mRNA 
0   11  43  34  NM_170343.1  CG5588-RA, transcript variant A (Mtl), mRNA 
0   14  33  NM_079568.2  CG9366-RA (RhoL), mRNA 
0   NM_134310.2  CG5771-RA, transcript variant A (Rab11), mRNA 
0   NM_057822.3  CG5771-RB, transcript variant B (Rab11), mRNA 
0   NM_134529.2  CG9575-RA (Rab35), mRNA 
0   NM_134613.2  CG1644-RA (Cyp6t1), mRNA 
0   NM_080005.2  CG3129-RA (Rab-RP4), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_132938.2  CG4789-RA (CG4789), mRNA 
0   NM_136468.1  CG12826-RA (CG12826), mRNA 
0   NM_170101.1  CG5320-RB, transcript variant B (Gdh), mRNA 
0   NM_206550.1  CG5320-RE, transcript variant E (Gdh), mRNA 
0   NM_079746.4  CG5320-RA, transcript variant A (Gdh), mRNA 
0   NM_206551.1  CG5320-RF, transcript variant F (Gdh), mRNA 
0   NM_167736.1  CG32521-RC, transcript variant C (CG32521), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.