National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2190R-1 
 Symbol hep  Full Name hemipterous 
 CG No CG4353  Old CG No CG2190 
 Synonyms HEP/MKK7, DJNKK, HEP, JNKK, MKK7, DHEP/MKK7, CG2190, CG4353, DMKK7, hp, l(1)G0107, l(1)G0208, l(1)7P1, hem, hep, Hep 
 Accession No (Link to NCBI) NM_167347.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rallis A, Moore C, Ng J.
Signal strength and signal duration define two distinct aspects of JNK-regulated axon stability.
Dev. Biol. (2010) 339(1) 65-77 [ PubMed ID = 20035736 ] [ RRC reference ]

Buchon N, Broderick NA, Chakrabarti S, Lemaitre B.
Invasive and indigenous microbiota impact intestinal stem cell activity through multiple pathways in Drosophila.
Genes Dev. (2009) 23(19) 2333-44 [ PubMed ID = 19797770 ] [ RRC reference ]

Ishimaru S, Ueda R, Hinohara Y, Ohtani M, Hanafusa H.
PVR plays a critical role via JNK activation in thorax closure during Drosophila metamorphosis.
EMBO J. (2004) 23(20) 3984-94 [ PubMed ID = 15457211 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTTTAGTAGCATCGGTGGG 
 Primer Seq. 3'
aatctagaggtaccAGCACTATGGGGCTCTGATTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTTTAGTA GCATCGGTGG GTTTGGCTCT ATAGATTTAG ATTTAGAAAA AAAAAAAGAA 
0061 TACTCTACCA ACTCATCACT TGCAGGTCAA TCGATTCTAC GCAATCTGAC AACATCGCCC 
0121 TTCAGCCAAA AGAAACACAA TTCAAATGCA ACAACAATAC CACTGCCGCA CAACAACCAA 
0181 ACATTGATCA CGGATGCAGC AACAGCAGCA GCAGCGGCGG CAACAGCAAC AACACCGCCA 
0241 AATATTGCAG CTACAGTGCT CACGACAACG CCAACGACCA CGCCCACTTG GCGCCTGCCA 
0301 ACGGAAAATT CCCAAGCCTA CGACAGCTGT GATAGTAGTA GTAATGCGAC CACGACGACC 
0361 TTGAATTTGG GCCTCTCCTC ACCCTCCCCC TCGTTGCCGC GCAAGCAATT CCCCACAGAA 
0421 TCGCCGACCC TGCAACTCAC GAGTCAGCAG CAGCAGCAGC CACAGCGANT TGCAGCCGGG 
0481 CAATCAGAGC CCCATAGTGC T 
 in silico PCR Fragment
0001 ATGTTTAGTA GCATCGGTGG GTTTGGCTCT ATAGATTTAG ATTTAGAAAA AAAAAAAGAA 
0061 TACTCTACCA ACTCATCACT TGCAGGTCAA TCGATTCTAC GCAATCTGAC AACATCGCCC 
0121 TTCAGCCAAA AGAAACACAA TTCAACTGCA ACAACAATAC CACTGCCGCA CAACAACCAA 
0181 ACATTGATCA CGGATGCAGC AACAGCAGCA GCAGCGGCGG CAACAGCAAC AACACCGCCA 
0241 AATATTGCAG CTACAGTGCT CACGACAACG CCAACGACCA CGCCCACTTG GCGCCTGCCA 
0301 ACGGAAAATT CCCAAGCCTA CGACAGCTGT GATAGTAGTA GTAATGCGAC CACGACGACC 
0361 TTGAATTTGG GCCTCTCCTC ACCCTCCCCC TCGTTGCCGC GCAAGCAATT CCCCACAGAA 
0421 TCGCCGACCC TGCAACTCAC GAGTCAGCAG CAGCAGCAGC CACAGCGA-T TGCAGCCGGG 
0481 CAATCAGAGC CCCATAGTGC T 
 Assemble Data

2190R-1.IR_full       1   ATGTTTAGTAGCATCGGTGGGTTTGGCTCTATAGATTTAGATTTAGAAAAAAAAAAAGAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2190R-1.in silico     1   ATGTTTAGTAGCATCGGTGGGTTTGGCTCTATAGATTTAGATTTAGAAAAAAAAAAAGAA 60


2190R-1.IR_full       61  TACTCTACCAACTCATCACTTGCAGGTCAATCGATTCTACGCAATCTGACAACATCGCCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2190R-1.in silico     61  TACTCTACCAACTCATCACTTGCAGGTCAATCGATTCTACGCAATCTGACAACATCGCCC 120


2190R-1.IR_full       121 TTCAGCCAAAAGAAACACAATTCAAATGCAACAACAATACCACTGCCGCACAACAACCAA 180
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
2190R-1.in silico     121 TTCAGCCAAAAGAAACACAATTCAACTGCAACAACAATACCACTGCCGCACAACAACCAA 180


2190R-1.IR_full       181 ACATTGATCACGGATGCAGCAACAGCAGCAGCAGCGGCGGCAACAGCAACAACACCGCCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2190R-1.in silico     181 ACATTGATCACGGATGCAGCAACAGCAGCAGCAGCGGCGGCAACAGCAACAACACCGCCA 240


2190R-1.IR_full       241 AATATTGCAGCTACAGTGCTCACGACAACGCCAACGACCACGCCCACTTGGCGCCTGCCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2190R-1.in silico     241 AATATTGCAGCTACAGTGCTCACGACAACGCCAACGACCACGCCCACTTGGCGCCTGCCA 300


2190R-1.IR_full       301 ACGGAAAATTCCCAAGCCTACGACAGCTGTGATAGTAGTAGTAATGCGACCACGACGACC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2190R-1.in silico     301 ACGGAAAATTCCCAAGCCTACGACAGCTGTGATAGTAGTAGTAATGCGACCACGACGACC 360


2190R-1.IR_full       361 TTGAATTTGGGCCTCTCCTCACCCTCCCCCTCGTTGCCGCGCAAGCAATTCCCCACAGAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2190R-1.in silico     361 TTGAATTTGGGCCTCTCCTCACCCTCCCCCTCGTTGCCGCGCAAGCAATTCCCCACAGAA 420


2190R-1.IR_full       421 TCGCCGACCCTGCAACTCACGAGTCAGCAGCAGCAGCAGCCACAGCGANTTGCAGCCGGG 480
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
2190R-1.in silico     421 TCGCCGACCCTGCAACTCACGAGTCAGCAGCAGCAGCAGCCACAGCGA-TTGCAGCCGGG 480


2190R-1.IR_full       481 CAATCAGAGCCCCATAGTGCT 501
                          |||||||||||||||||||||
2190R-1.in silico     481 CAATCAGAGCCCCATAGTGCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  53  NM_167347.1  CG4353-RB, transcript variant B (hep), mRNA 
82.57   398  67  NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
2.69   13  174  810  1953  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
2.69   13  174  810  1948  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
2.69   13  174  810  1948  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
2.69   13  36  119  324  NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
2.07   10  62  320  913  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
2.07   10  62  320  913  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
1.65   27  97  305  NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
1.65   27  97  305  NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
1.45   10  43  115  NM_132562.1  CG12720-RA (CG12720), mRNA 
1.24   49  199  592  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
1.24   49  199  592  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
1.24   37  158  381  NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
1.24   37  158  381  NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
1.24   36  156  554  NM_139493.2  CG2083-RA (CG2083), mRNA 
1.24   29  136  437  NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
1.24   29  136  436  NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
1.24   29  92  328  NM_135785.1  CG6043-RD, transcript variant D (CG6043), mRNA 
1.24   29  92  328  NM_165035.1  CG6043-RB, transcript variant B (CG6043), mRNA 
1.24   29  92  328  NM_165037.1  CG6043-RC, transcript variant C (CG6043), mRNA 
1.24   29  92  328  NM_165034.1  CG6043-RA, transcript variant A (CG6043), mRNA 
1.24   26  123  380  NM_079507.2  CG2530-RA (corto), mRNA 
1.24   21  62  256  NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
1.24   21  62  256  NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
1.24   21  62  256  NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
1.24   16  91  338  NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
1.24   16  90  326  NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
1.24   14  81  262  NM_170628.1  CG7391-RB, transcript variant B (Clk), mRNA 
1.24   14  81  262  NM_206299.1  CG7391-RC, transcript variant C (Clk), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.