National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2125R-1 
 Symbol ci  Full Name cubitus interruptus 
 CG No CG2125  Old CG No CG2125 
 Synonyms Gli, Ci, CI, CG2125, ci155, CID, CiD, ciD, l(4)17, ci[D], ci-D, Ci[D], Ce, l(4)13, l(4)102ABc, ci, Ci/GLI 
 Accession No (Link to NCBI) NM_079878.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Zhang Z, Feng J, Pan C, Lv X, Wu W, Zhou Z, Liu F, Zhang L, Zhao Y.
Atrophin-Rpd3 complex represses Hedgehog signaling by acting as a corepressor of CiR.
J. Cell Biol. (2013) 203(4) 575-83 [ PubMed ID = 24385484 ] [ RRC reference ]

Terriente-Félix A, Molnar C, Gómez-Skarmeta JL, de Celis JF.
A conserved function of the chromatin ATPase Kismet in the regulation of hedgehog expression.
Dev. Biol. (2011) 350(2) 382-92 [ PubMed ID = 21146514 ] [ RRC reference ]

Han H, Pan C, Liu C, Lv X, Yang X, Xiong Y, Lu Y, Wu W, Han J, Zhou Z, Jiang H, Zhang L, Zhao Y.
Gut-neuron interaction via Hh signaling regulates intestinal progenitor cell differentiation in Drosophila.
Cell Discov (2015) 1 15006 [ PubMed ID = 27462407 ] [ RRC reference ]

Lai CM, Lin KY, Kao SH, Chen YN, Huang F, Hsu HJ.
Hedgehog signaling establishes precursors for germline stem cell niches by regulating cell adhesion.
J. Cell Biol. (2017) 216(5) 1439-1453 [ PubMed ID = 28363970 ] [ RRC reference ]

Zhang Z, Lv X, Jiang J, Zhang L, Zhao Y.
Dual roles of Hh signaling in the regulation of somatic stem cell self-renewal and germline stem cell maintenance in Drosophila testis.
Cell Res. (2013) 23(4) 573-6 [ PubMed ID = 23419515 ] [ RRC reference ]

Sato T, Ogata J, Niki Y.
BMP and Hh signaling affects primordial germ cell division in Drosophila.
Zool. Sci. (2010) 27(10) 804-10 [ PubMed ID = 20887178 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAAATGGACGCCTACGCGTTA 
 Primer Seq. 3'
aatctagaggtaccCAGCAGCATTATGCAGTTCAC 
 Predicted Fragment Size
523 
 IR fragment full Seq
0001 GAAATGNGAC GCCTACGCGT TACCTACATA TTTTCCTCTT GCGTATTCTG AATTGCAGTT 
0061 TTTAGCGTCC AGGAGAGCAG CTGCCGTCGC TGCAGCGGCT ACTGTTTTAC CAGGATCACC 
0121 ATGCATAAAC CAACATCACC CAACTGACGT TTCAAGCTCG GTAACAGTGC CATCAATTAT 
0181 TCCAACGGGT GGAACATCAG ATTCAATTAA AACTTCAATA CAACCACAAA TATGCAATGA 
0241 AAACACCCTT CTTGGAAATG CTGGCCACCA GCACAATCAT CAGCCTCAAC ATGTTCACAA 
0301 TATAAATGTT ACTGGACAGC CACATGACTT TCACCCGGCC TATAGAATTC CCGGATACAT 
0361 GGAACAGTTG TATTCTCTTC AACGAACTAA TTCAGCTTCA TCTTTTCACG ATCCCTATGT 
0421 CAATTGTGCA TCAGCATTCC ATCTTGCCGG ACTTGGTTTG GGATCAGCTG ATTTTTTGGG 
0481 CAGCCGAGGT TTGAGCTCTT TGGGTGAACT GCATAATGCT GCTG 
 in silico PCR Fragment
0001 GAAATG-GAC GCCTACGCGT TACCTACATA TTTTCCTCTT GCGTATTCTG AATTGCAGTT 
0061 TTTAGCGTCC AGGAGAGCAG CTGCCGTCGC TGCAGCGGCT ACTGTTTTAC CAGGATCACC 
0121 ATGCATAAAC CAACATCACC CAACTGACGT TTCAAGCTCG GTAACAGTGC CATCAATTAT 
0181 TCCAACGGGT GGAACATCAG ATTCAATTAA AACTTCAATA CAACCACAAA TATGCAATGA 
0241 AAACACCCTT CTTGGAAATG CTGGCCACCA GCACAATCAT CAGCCTCAAC ATGTTCACAA 
0301 TATAAATGTT ACTGGACAGC CACATGACTT TCACCCGGCC TATAGAATTC CCGGATACAT 
0361 GGAACAGTTG TATTCTCTTC AACGAACTAA TTCAGCTTCA TCTTTTCACG ATCCCTATGT 
0421 CAATTGTGCA TCAGCATTCC ATCTTGCCGG ACTTGGTTTG GGATCAGCTG ATTTTTTGGG 
0481 CAGCCGAGGT TTGAGCTCTT TGGGTGAACT GCATAATGCT GCTG 
 Assemble Data

2125R-1.IR_full       1   GAAATGNGACGCCTACGCGTTACCTACATATTTTCCTCTTGCGTATTCTGAATTGCAGTT 60
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
2125R-1.in silico     1   GAAATG-GACGCCTACGCGTTACCTACATATTTTCCTCTTGCGTATTCTGAATTGCAGTT 60


2125R-1.IR_full       61  TTTAGCGTCCAGGAGAGCAGCTGCCGTCGCTGCAGCGGCTACTGTTTTACCAGGATCACC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2125R-1.in silico     61  TTTAGCGTCCAGGAGAGCAGCTGCCGTCGCTGCAGCGGCTACTGTTTTACCAGGATCACC 120


2125R-1.IR_full       121 ATGCATAAACCAACATCACCCAACTGACGTTTCAAGCTCGGTAACAGTGCCATCAATTAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2125R-1.in silico     121 ATGCATAAACCAACATCACCCAACTGACGTTTCAAGCTCGGTAACAGTGCCATCAATTAT 180


2125R-1.IR_full       181 TCCAACGGGTGGAACATCAGATTCAATTAAAACTTCAATACAACCACAAATATGCAATGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2125R-1.in silico     181 TCCAACGGGTGGAACATCAGATTCAATTAAAACTTCAATACAACCACAAATATGCAATGA 240


2125R-1.IR_full       241 AAACACCCTTCTTGGAAATGCTGGCCACCAGCACAATCATCAGCCTCAACATGTTCACAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2125R-1.in silico     241 AAACACCCTTCTTGGAAATGCTGGCCACCAGCACAATCATCAGCCTCAACATGTTCACAA 300


2125R-1.IR_full       301 TATAAATGTTACTGGACAGCCACATGACTTTCACCCGGCCTATAGAATTCCCGGATACAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2125R-1.in silico     301 TATAAATGTTACTGGACAGCCACATGACTTTCACCCGGCCTATAGAATTCCCGGATACAT 360


2125R-1.IR_full       361 GGAACAGTTGTATTCTCTTCAACGAACTAATTCAGCTTCATCTTTTCACGATCCCTATGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2125R-1.in silico     361 GGAACAGTTGTATTCTCTTCAACGAACTAATTCAGCTTCATCTTTTCACGATCCCTATGT 420


2125R-1.IR_full       421 CAATTGTGCATCAGCATTCCATCTTGCCGGACTTGGTTTGGGATCAGCTGATTTTTTGGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2125R-1.in silico     421 CAATTGTGCATCAGCATTCCATCTTGCCGGACTTGGTTTGGGATCAGCTGATTTTTTGGG 480


2125R-1.IR_full       481 CAGCCGAGGTTTGAGCTCTTTGGGTGAACTGCATAATGCTGCTG 524
                          ||||||||||||||||||||||||||||||||||||||||||||
2125R-1.in silico     481 CAGCCGAGGTTTGAGCTCTTTGGGTGAACTGCATAATGCTGCTG 524

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   505  NM_079878.3  CG2125-RA (ci), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   17  14  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   11  NM_132640.2  CG1770-RA, transcript variant A (HDAC4), mRNA 
0   11  NM_001014736.1  CG1770-RC, transcript variant C (HDAC4), mRNA 
0   11  NM_167356.1  CG1770-RB, transcript variant B (HDAC4), mRNA 
0   NM_134890.2  CG17265-RA (CG17265), mRNA 
0   NM_135186.1  CG16947-RA (CG16947), mRNA 
0   NM_141676.2  CG12950-RA (CG12950), mRNA 
0   NM_136646.1  CG13953-RA (CG13953), mRNA 
0   NM_176036.1  CG32973-RA (CG32973), mRNA 
0   NM_079416.2  CG4166-RA (not), mRNA 
0   NM_170570.1  CG1873-RB, transcript variant B (Ef1alpha100E), mRNA 
0   NM_206592.1  CG1873-RD, transcript variant D (Ef1alpha100E), mRNA 
0   NM_079872.4  CG1873-RA, transcript variant A (Ef1alpha100E), mRNA 
0   NM_206593.1  CG1873-RC, transcript variant C (Ef1alpha100E), mRNA 
0   NM_137507.3  CG5341-RA (sec6), mRNA 
0   NM_134964.1  CG3921-RA (CG3921), mRNA 
0   NM_138052.2  CG3356-RA (CG3356), mRNA 
0   NM_141458.2  CG32466-RA, transcript variant A (rn), mRNA 
0   NM_169170.1  CG1070-RC, transcript variant C (Alh), mRNA 
0   NM_169171.1  CG1070-RD, transcript variant D (Alh), mRNA 
0   NM_079526.2  CG1070-RA, transcript variant A (Alh), mRNA 
0   NM_169172.1  CG1070-RB, transcript variant B (Alh), mRNA 
0   NM_057338.2  CG8246-RA (Poxn), mRNA 
0   NM_168131.1  CG5505-RA, transcript variant A (mule), mRNA 
0   NM_168132.1  CG5505-RD, transcript variant D (mule), mRNA 
0   NM_139729.2  CG5505-RE, transcript variant E (mule), mRNA 
0   NM_168135.1  CG5505-RB, transcript variant B (mule), mRNA 
0   NM_168133.1  CG5505-RF, transcript variant F (mule), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.