National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2114R-1 
 Symbol FR  Full Name Fmrf Receptor 
 CG No CG2114  Old CG No CG2114 
 Synonyms CG2114, FMRFaR, DrmFMRFa-R, FR 
 Accession No (Link to NCBI) NM_139501.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kiss B, Szlanka T, Zvara Á, Žurovec M, Sery M, Kakaš Š, Ramasz B, Hegedűs Z, Lukacsovich T, Puskás L, Fónagy A, Kiss I.
Selective elimination/RNAi silencing of FMRF-related peptides and their receptors decreases the locomotor activity in Drosophila melanogaster.
Gen. Comp. Endocrinol. (2013) 191 137-45 [ PubMed ID = 23770020 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACGGTGGACCCATCAGCGAC 
 Primer Seq. 3'
aatctagaggtaccACCGCCGGCGATATAAACGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACGGTGGAC CCATCAGCGA CGATGAGTTC CTGGCCAGTG CGATGGcCAC CGAGGGCCCA 
0061 ACGGTACGCT ACGATTTGTT TCCGCAGAAC AACAGTCAGC CCACTCTGCA AATCGTCCTT 
0121 AACCACACGG AGGTGCAAAC GGATCTGCAA TATCCCCACT ACGAGGACCT GGGCCTGGAT 
0181 CCCGATCCGA ATTGGACACG AATCTGCGAG GATGTGTACA ACCCACTGCT GGAGAACAAT 
0241 CGCATTGAGT TCTGGGTGTG CGGAGTACTG ATAAATATCG TTGGTGTCCT CGGCATCCTA 
0301 GGCAACATAA TCTCCATGAT AATCCTCTCC CGACCACAGA TGAGATCCAG TATCAACTAC 
0361 TTGCTCACTG GATTGGCCCG CTGTGATACG GTGCTGATTA TCACCTCTAT CCTGCTGTTT 
0421 GGAATACCCA GCATATATCC ATATACGGGT CACTTTTTCG GCTACTACAA CTATGTTTAT 
0481 CCGTTTATAT CGCCGGCGGT  
 in silico PCR Fragment
0001 TACGGTGGAC CCATCAGCGA CGATGAGTTC CTGGCCAGTG CGATGGCCAC CGAGGGCCCA 
0061 ACGGTACGCT ACGATTTGTT TCCGCAGAAC AACAGTCAGC CCACTCTGCA AATCGTCCTT 
0121 AACCACACGG AGGTGCAAAC GGATCTGCAA TATCCCCACT ACGAGGACCT GGGCCTGGAT 
0181 CCCGATCCGA ATTGGACACG AATCTGCGAG GATGTGTACA ACCCACTGCT GGAGAACAAT 
0241 CGCATTGAGT TCTGGGTGTG CGGAGTACTG ATAAATATCG TTGGTGTCCT CGGCATCCTA 
0301 GGCAACATAA TCTCCATGAT AATCCTCTCC CGACCACAGA TGAGATCCAG TATCAACTAC 
0361 TTGCTCACTG GATTGGCCCG CTGTGATACG GTGCTGATTA TCACCTCTAT CCTGCTGTTT 
0421 GGAATACCCA GCATATATCC ATATACGGGT CACTTTTTCG GCTACTACAA CTATGTTTAT 
0481 CCGTTTATAT CGCCGGCGGT  
 Assemble Data

2114R-1.IR_full       1   TACGGTGGACCCATCAGCGACGATGAGTTCCTGGCCAGTGCGATGGCCACCGAGGGCCCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2114R-1.in silico     1   TACGGTGGACCCATCAGCGACGATGAGTTCCTGGCCAGTGCGATGGCCACCGAGGGCCCA 60


2114R-1.IR_full       61  ACGGTACGCTACGATTTGTTTCCGCAGAACAACAGTCAGCCCACTCTGCAAATCGTCCTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2114R-1.in silico     61  ACGGTACGCTACGATTTGTTTCCGCAGAACAACAGTCAGCCCACTCTGCAAATCGTCCTT 120


2114R-1.IR_full       121 AACCACACGGAGGTGCAAACGGATCTGCAATATCCCCACTACGAGGACCTGGGCCTGGAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2114R-1.in silico     121 AACCACACGGAGGTGCAAACGGATCTGCAATATCCCCACTACGAGGACCTGGGCCTGGAT 180


2114R-1.IR_full       181 CCCGATCCGAATTGGACACGAATCTGCGAGGATGTGTACAACCCACTGCTGGAGAACAAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2114R-1.in silico     181 CCCGATCCGAATTGGACACGAATCTGCGAGGATGTGTACAACCCACTGCTGGAGAACAAT 240


2114R-1.IR_full       241 CGCATTGAGTTCTGGGTGTGCGGAGTACTGATAAATATCGTTGGTGTCCTCGGCATCCTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2114R-1.in silico     241 CGCATTGAGTTCTGGGTGTGCGGAGTACTGATAAATATCGTTGGTGTCCTCGGCATCCTA 300


2114R-1.IR_full       301 GGCAACATAATCTCCATGATAATCCTCTCCCGACCACAGATGAGATCCAGTATCAACTAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2114R-1.in silico     301 GGCAACATAATCTCCATGATAATCCTCTCCCGACCACAGATGAGATCCAGTATCAACTAC 360


2114R-1.IR_full       361 TTGCTCACTGGATTGGCCCGCTGTGATACGGTGCTGATTATCACCTCTATCCTGCTGTTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2114R-1.in silico     361 TTGCTCACTGGATTGGCCCGCTGTGATACGGTGCTGATTATCACCTCTATCCTGCTGTTT 420


2114R-1.IR_full       421 GGAATACCCAGCATATATCCATATACGGGTCACTTTTTCGGCTACTACAACTATGTTTAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2114R-1.in silico     421 GGAATACCCAGCATATATCCATATACGGGTCACTTTTTCGGCTACTACAACTATGTTTAT 480


2114R-1.IR_full       481 CCGTTTATATCGCCGGCGGT 500
                          ||||||||||||||||||||
2114R-1.in silico     481 CCGTTTATATCGCCGGCGGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139501.2  CG2114-RA (FR), mRNA 
0   NM_164695.1  CG11050-RC, transcript variant C (CG11050), mRNA 
0   NM_164694.1  CG11050-RB, transcript variant B (CG11050), mRNA 
0   NM_135208.4  CG11050-RA, transcript variant A (CG11050), mRNA 
0   NM_132072.1  CG14446-RA (CG14446), mRNA 
0   NM_135853.2  CG18095-RA (CG18095), mRNA 
0   NM_169335.2  CG3985-RC, transcript variant C (Syn), mRNA 
0   NM_169332.2  CG3985-RA, transcript variant A (Syn), mRNA 
0   NM_176451.2  CG3985-RF, transcript variant F (Syn), mRNA 
0   NM_169334.2  CG3985-RD, transcript variant D (Syn), mRNA 
0   NM_169333.2  CG3985-RE, transcript variant E (Syn), mRNA 
0   NM_132801.1  CG15641-RA (CG15641), mRNA 
0   NM_164570.1  CG31961-RA, transcript variant A (CG31961), mRNA 
0   NM_164571.1  CG31961-RB, transcript variant B (CG31961), mRNA 
0   NM_166213.2  CG6953-RB, transcript variant B (fat-spondin), mRNA 
0   NM_058087.4  CG6953-RA, transcript variant A (fat-spondin), mRNA 
0   NM_144056.2  CG15234-RA (CG15234), mRNA 
0   NM_136689.1  CG30007-RB, transcript variant B (CG30007), mRNA 
0   NM_165719.1  CG30007-RA, transcript variant A (CG30007), mRNA 
0   NM_169964.1  CG31343-RA (CG31343), mRNA 
0   NM_079099.1  CG17226-RA (Or59c), mRNA 
0   NM_142169.2  CG4196-RC, transcript variant C (CG4196), mRNA 
0   NM_170649.1  CG4196-RB, transcript variant B (CG4196), mRNA 
0   NM_078845.3  CG15274-RA (GABA-B-R1), mRNA 
0   NM_132642.2  CG15744-RA (CG15744), mRNA 
0   NM_132759.1  CG9503-RA (CG9503), mRNA 
0   NM_143328.1  CG12875-RA (CG12875), mRNA 
0   NM_141799.1  CG17187-RA (CG17187), mRNA 
0   NM_141883.1  CG3397-RA (CG3397), mRNA 
0   NM_137987.2  CG5539-RA (CG5539), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.