National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2114R-1 
 Symbol FR  Full Name Fmrf Receptor 
 CG No CG2114  Old CG No CG2114 
 Synonyms CG2114, FMRFaR, DrmFMRFa-R, FR 
 Accession No (Link to NCBI) NM_139501.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Kiss B, Szlanka T, Zvara Á, Žurovec M, Sery M, Kakaš Š, Ramasz B, Hegedűs Z, Lukacsovich T, Puskás L, Fónagy A, Kiss I.
Selective elimination/RNAi silencing of FMRF-related peptides and their receptors decreases the locomotor activity in Drosophila melanogaster.
Gen. Comp. Endocrinol. (2013) 191 137-45 [ PubMed ID = 23770020 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TACGGTGGACCCATCAGCGACGATGAGTTCCTGGCCAGTGCGATGGCCACCGAGGGCCCA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACGGTACGCTACGATTTGTTTCCGCAGAACAACAGTCAGCCCACTCTGCAAATCGTCCTT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AACCACACGGAGGTGCAAACGGATCTGCAATATCCCCACTACGAGGACCTGGGCCTGGAT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCCGATCCGAATTGGACACGAATCTGCGAGGATGTGTACAACCCACTGCTGGAGAACAAT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGCATTGAGTTCTGGGTGTGCGGAGTACTGATAAATATCGTTGGTGTCCTCGGCATCCTA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGCAACATAATCTCCATGATAATCCTCTCCCGACCACAGATGAGATCCAGTATCAACTAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTGCTCACTGGATTGGCCCGCTGTGATACGGTGCTGATTATCACCTCTATCCTGCTGTTT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGAATACCCAGCATATATCCATATACGGGTCACTTTTTCGGCTACTACAACTATGTTTAT 480

2114R-1.IR_full       481 CCGTTTATATCGCCGGCGGT 500
                          |||||||||||||||||||| silico     481 CCGTTTATATCGCCGGCGGT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139501.2  CG2114-RA (FR), mRNA 
0   NM_164695.1  CG11050-RC, transcript variant C (CG11050), mRNA 
0   NM_164694.1  CG11050-RB, transcript variant B (CG11050), mRNA 
0   NM_135208.4  CG11050-RA, transcript variant A (CG11050), mRNA 
0   NM_132072.1  CG14446-RA (CG14446), mRNA 
0   NM_135853.2  CG18095-RA (CG18095), mRNA 
0   NM_169335.2  CG3985-RC, transcript variant C (Syn), mRNA 
0   NM_169332.2  CG3985-RA, transcript variant A (Syn), mRNA 
0   NM_176451.2  CG3985-RF, transcript variant F (Syn), mRNA 
0   NM_169334.2  CG3985-RD, transcript variant D (Syn), mRNA 
0   NM_169333.2  CG3985-RE, transcript variant E (Syn), mRNA 
0   NM_132801.1  CG15641-RA (CG15641), mRNA 
0   NM_164570.1  CG31961-RA, transcript variant A (CG31961), mRNA 
0   NM_164571.1  CG31961-RB, transcript variant B (CG31961), mRNA 
0   NM_166213.2  CG6953-RB, transcript variant B (fat-spondin), mRNA 
0   NM_058087.4  CG6953-RA, transcript variant A (fat-spondin), mRNA 
0   NM_144056.2  CG15234-RA (CG15234), mRNA 
0   NM_136689.1  CG30007-RB, transcript variant B (CG30007), mRNA 
0   NM_165719.1  CG30007-RA, transcript variant A (CG30007), mRNA 
0   NM_169964.1  CG31343-RA (CG31343), mRNA 
0   NM_079099.1  CG17226-RA (Or59c), mRNA 
0   NM_142169.2  CG4196-RC, transcript variant C (CG4196), mRNA 
0   NM_170649.1  CG4196-RB, transcript variant B (CG4196), mRNA 
0   NM_078845.3  CG15274-RA (GABA-B-R1), mRNA 
0   NM_132642.2  CG15744-RA (CG15744), mRNA 
0   NM_132759.1  CG9503-RA (CG9503), mRNA 
0   NM_143328.1  CG12875-RA (CG12875), mRNA 
0   NM_141799.1  CG17187-RA (CG17187), mRNA 
0   NM_141883.1  CG3397-RA (CG3397), mRNA 
0   NM_137987.2  CG5539-RA (CG5539), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.