National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2107R-2 
 Symbol CG2107  Full Name CG2107 
 CG No CG2107  Old CG No CG2107 
 Synonyms CG2107 
 Accession No (Link to NCBI) NM_139499.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Schulz JG, Laranjeira A, Van Huffel L, Gärtner A, Vilain S, Bastianen J, Van Veldhoven PP, Dotti CG.
Glial β-oxidation regulates Drosophila energy metabolism.
Sci Rep (2015) 5 7805 [ PubMed ID = 25588812 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTATCGACGAACTCGTCGAGGA 
 Primer Seq. 3'
aatctagaggtaccGCTCTTCTTGGCGTTCATGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TATCGACGAA CTCGTCGAGA GACAACGACC ACTCATGGCC AGCACTACCA ATACCTGCAA 
0061 TGTTCCAAGC TGCCAACGCT GTACTTTCAG CGCTCCTTGC CGCGATTGCC CATTCCTCTG 
0121 TTGGAGAACA GCTGTCGGCG TTTCCTGGAG GCCACCAAGC CACTACTCTC GCCGGCGGAG 
0181 CAGGCGCAGN ACCCAGCAAA CGGTGGAACA GTTTCGCCAG GGGATCGGCA TGGAACTACA 
0241 CGCGAAACTC AAGAGCCATG ATGCAGAGAA CAAGCATACC AGCTACATCT CGCAGCCCTG 
0301 GTTCGACATG TATCTAGCCG ATCGAGCGCC CCTGCCACTC AACTATAATC CGCTGCTGGT 
0361 GATGAAAAGC GACGCGCGAN CCGGAGTACC AGCAACAGGT GGTTAGGGCT ACCAACCTGA 
0421 TCATCAGCTC GTTACGGTTC TGGCGATCTC TGCAGGCGGA TCTCCTGGAG CCGGAGGTGT 
0481 ACCACATGAA CGCCAAGAAG AGC 
 in silico PCR Fragment
0001 TATCGACGAA CTCGTCGAG- GACAACGACC ACTCATGGCC AGCACTACCA ATACCTGCAA 
0061 TGTTCCAAGC TGCCAACGCT GTACTTTCAG CGCTCCTTGC CGCGATTGCC CATTCCTCTG 
0121 TTGGAGAACA GCTGTCGGCG TTTCCTGGAG GCCACCAAGC CACTACTCTC GCCGGCGGAG 
0181 CAGGCGCAG- ACCCAGCAAA CGGTGGAACA GTTTCGCCAG GGGATCGGCA TGGAACTACA 
0241 CGCGAAACTC AAGAGCCATG ATGCAGAGAA CAAGCATACC AGCTACATCT CGCAGCCCTG 
0301 GTTCGACATG TATCTAGCCG ATCGAGCGCC CCTGCCACTC AACTATAATC CGCTGCTGGT 
0361 GATGAAAAGC GACGCGCGA- CCGGAGTACC AGCAACAGGT GGTTAGGGCT ACCAACCTGA 
0421 TCATCAGCTC GTTACGGTTC TGGCGATCTC TGCAGGCGGA TCTCCTGGAG CCGGAGGTGT 
0481 ACCACATGAA CGCCAAGAAG AGC 
 Assemble Data

2107R-2.IR_full       1   TATCGACGAACTCGTCGAGAGACAACGACCACTCATGGCCAGCACTACCAATACCTGCAA 60
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
2107R-2.in silico     1   TATCGACGAACTCGTCGAG-GACAACGACCACTCATGGCCAGCACTACCAATACCTGCAA 60


2107R-2.IR_full       61  TGTTCCAAGCTGCCAACGCTGTACTTTCAGCGCTCCTTGCCGCGATTGCCCATTCCTCTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2107R-2.in silico     61  TGTTCCAAGCTGCCAACGCTGTACTTTCAGCGCTCCTTGCCGCGATTGCCCATTCCTCTG 120


2107R-2.IR_full       121 TTGGAGAACAGCTGTCGGCGTTTCCTGGAGGCCACCAAGCCACTACTCTCGCCGGCGGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2107R-2.in silico     121 TTGGAGAACAGCTGTCGGCGTTTCCTGGAGGCCACCAAGCCACTACTCTCGCCGGCGGAG 180


2107R-2.IR_full       181 CAGGCGCAGNACCCAGCAAACGGTGGAACAGTTTCGCCAGGGGATCGGCATGGAACTACA 240
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
2107R-2.in silico     181 CAGGCGCAG-ACCCAGCAAACGGTGGAACAGTTTCGCCAGGGGATCGGCATGGAACTACA 240


2107R-2.IR_full       241 CGCGAAACTCAAGAGCCATGATGCAGAGAACAAGCATACCAGCTACATCTCGCAGCCCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2107R-2.in silico     241 CGCGAAACTCAAGAGCCATGATGCAGAGAACAAGCATACCAGCTACATCTCGCAGCCCTG 300


2107R-2.IR_full       301 GTTCGACATGTATCTAGCCGATCGAGCGCCCCTGCCACTCAACTATAATCCGCTGCTGGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2107R-2.in silico     301 GTTCGACATGTATCTAGCCGATCGAGCGCCCCTGCCACTCAACTATAATCCGCTGCTGGT 360


2107R-2.IR_full       361 GATGAAAAGCGACGCGCGANCCGGAGTACCAGCAACAGGTGGTTAGGGCTACCAACCTGA 420
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
2107R-2.in silico     361 GATGAAAAGCGACGCGCGA-CCGGAGTACCAGCAACAGGTGGTTAGGGCTACCAACCTGA 420


2107R-2.IR_full       421 TCATCAGCTCGTTACGGTTCTGGCGATCTCTGCAGGCGGATCTCCTGGAGCCGGAGGTGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2107R-2.in silico     421 TCATCAGCTCGTTACGGTTCTGGCGATCTCTGCAGGCGGATCTCCTGGAGCCGGAGGTGT 480


2107R-2.IR_full       481 ACCACATGAACGCCAAGAAGAGC 503
                          |||||||||||||||||||||||
2107R-2.in silico     481 ACCACATGAACGCCAAGAAGAGC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139499.2  CG2107-RA (CG2107), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   NM_079902.2  CG6741-RB, transcript variant B (a), mRNA 
0   NM_166514.1  CG6741-RA, transcript variant A (a), mRNA 
0   NM_001014543.1  CG6741-RC, transcript variant C (a), mRNA 
0   NM_142659.1  CG17271-RA, transcript variant A (CG17271), mRNA 
0   NM_001043269.1  CG17271-RB, transcript variant B (CG17271), mRNA 
0   NM_137975.1  CG30183-RA (CG30183), mRNA 
0   NM_079114.1  CG11290-RA (enok), mRNA 
0   NM_169941.1  CG5685-RC, transcript variant C (Calx), mRNA 
0   NM_169940.1  CG5685-RB, transcript variant B (Calx), mRNA 
0   NM_079699.2  CG5685-RA, transcript variant A (Calx), mRNA 
0   NM_136477.2  CG30497-RA, transcript variant A (CG30497), mRNA 
0   NM_166677.1  CG3541-RB, transcript variant B (pio), mRNA 
0   NM_206252.2  CG16973-RB, transcript variant B (msn), mRNA 
0   NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0   NM_206249.2  CG16973-RE, transcript variant E (msn), mRNA 
0   NM_206251.2  CG16973-RD, transcript variant D (msn), mRNA 
0   NM_206250.2  CG16973-RC, transcript variant C (msn), mRNA 
0   NM_135229.2  CG17378-RA, transcript variant A (CG17378), mRNA 
0   NM_164710.1  CG17378-RB, transcript variant B (CG17378), mRNA 
0   NM_130502.2  CG12311-RA (Pomt2), mRNA 
0   NM_169082.1  CG31551-RA (CG31551), mRNA 
0   NM_164561.2  CG3920-RB, transcript variant B (l(2)k16918), mRNA 
0   NM_143795.3  CG3920-RA, transcript variant A (l(2)k16918), mRNA 
0   NM_140227.1  CG6084-RA, transcript variant A (CG6084), mRNA 
0   NM_168467.1  CG6084-RB, transcript variant B (CG6084), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 
0   NM_166548.2  CG30092-RB, transcript variant B (jbug), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.