National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2103R-2 
 Symbol pgant6  Full Name polypeptide GalNAc transferase 6 
 CG No CG2103  Old CG No CG2103 
 Synonyms CG2103, pgant6 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGGCCTCGCTGCTCTTGTTG 
 Primer Seq. 3'
aatctagaggtaccGAATCCGAGAGCAGGGCATTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

2103R-2.IR full       1   GAAGGCCTCGCTGCTCTTGTTGATCTCACTGACTCTCTTCGTACTGATAACCAGCTGGAT 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-2.in silico     1   -AAGGCCTCGCTGCTCTTGTTGATCTCACTGACTCTCTTCGTACTGATAACCAGCTGGAT 60


2103R-2.IR full       61  CTCATCTACTCCGTACACCAACAAGCCAGTCCATCATGGCGTGGAGCCCGTGCCCGAAAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-2.in silico     61  CTCATCTACTCCGTACACCAACAAGCCAGTCCATCATGGCGTGGAGCCCGTGCCCGAAAA 120


2103R-2.IR full       121 GGCTGGCCTTTCCGGCGATGTCAAGGTGAAGGTGCCAGCTATAAAGCAACCAGAACCTCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-2.in silico     121 GGCTGGCCTTTCCGGCGATGTCAAGGTGAAGGTGCCAGCTATAAAGCAACCAGAACCTCA 180


2103R-2.IR full       181 GAAACCACAGGAACCCGACTTCGAAGAGGATCCTGAGCTGCAGAAGATCGATGAGCCCGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-2.in silico     181 GAAACCACAGGAACCCGACTTCGAAGAGGATCCTGAGCTGCAGAAGATCGATGAGCCCGA 240


2103R-2.IR full       241 ACCGGTGGAGGAAGAAGTCGATAATCCGCATCCGGCGGACGACGAACCGCAACAGCAGCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-2.in silico     241 ACCGGTGGAGGAAGAAGTCGATAATCCGCATCCGGCGGACGACGAACCGCAACAGCAGCC 300


2103R-2.IR full       301 CCAGGAGGAGCTCCAAATGGCTGCGCCGGCGGACGCTTCGGTGAAGAAGGACTGGCACGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-2.in silico     301 CCAGGAGGAGCTCCAAATGGCTGCGCCGGCGGACGCTTCGGTGAAGAAGGACTGGCACGA 360


2103R-2.IR full       361 CTATACTTTCATGGAAAAGGATGCCAAGCGCGTGGGCCTCGGGGAGGGCGGAAAGGCATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-2.in silico     361 CTATACTTTCATGGAAAAGGATGCCAAGCGCGTGGGCCTCGGGGAGGGCGGAAAGGCATC 420


2103R-2.IR full       421 GACGCTCGACGATGAGTCCCAGCGAGACTTGGAGAAGCGAATGTCCCTGGAAAATGGATT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-2.in silico     421 GACGCTCGACGATGAGTCCCAGCGAGACTTGGAGAAGCGAATGTCCCTGGAAAATGGATT 480


2103R-2.IR full       481 TAATGCCCTGCTCTCGGATTC 501
                          |||||||||||||||||||||
2103R-2.in silico     481 TAATGCCCTGCTCTCGGATTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_139492.2  polypeptide GalNAc transferase 6 CG2103-RA, transcript variant A (pgant6), mRNA 
100  482  NM_167966.1  polypeptide GalNAc transferase 6 CG2103-RB, transcript variant B (pgant6), mRNA 
NM_141246.1  CG14659-RA (CG14659), mRNA 
NM_142751.1  CG5778-RA (CG5778), mRNA 
NM_078865.2  Dorsal-related immunity factor CG6794-RA, transcript variant A (Dif), mRNA 
NM_165216.1  Dorsal-related immunity factor CG6794-RB, transcript variant B (Dif), mRNA 
NM_141333.2  CG2046-RA (CG2046), mRNA 
NM_139551.1  CG14961-RA (CG14961), mRNA 
10  NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
10  NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
NM_164575.1  CG3714-RE, transcript variant E (CG3714), mRNA 
NM_164572.1  CG3714-RA, transcript variant A (CG3714), mRNA 
NM_134974.4  CG3714-RB, transcript variant B (CG3714), mRNA 
NM_164573.1  CG3714-RC, transcript variant C (CG3714), mRNA 
NM_164574.1  CG3714-RD, transcript variant D (CG3714), mRNA 
15  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
13  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
NM_164381.1  Equilibrative nucleoside transporter 1 CG11907-RA, transcript variant A (Ent1), mRNA 
NM_134675.4  Equilibrative nucleoside transporter 1 CG11907-RB, transcript variant B (Ent1), mRNA 
NM_143722.2  ENL/AF9-related CG4913-RA (ear), mRNA 
NM_206769.1  CG9125-RA (CG9125), mRNA 
NM_080156.2  FK506-binding protein FKBP59 CG4535-RA (FKBP59), mRNA 
NM_142270.1  CG8927-RA, transcript variant A (CG8927), mRNA 
NM_001038967.1  CG8927-RB, transcript variant B (CG8927), mRNA 
NM_141723.1  CG6208-RA (CG6208), mRNA 
NM_164876.1  CG31711-RA (CG31711), mRNA 
NM_141237.1  CG14655-RA (CG14655), mRNA 
18  31  NM_164808.2  CG31901-RA (CG31901), mRNA 
NM_143516.2  CG15529-RA (CG15529), mRNA 
NM_139399.1  CG13921-RA, transcript variant A (CG13921), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.