National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2103R-1 
 Symbol pgant6  Full Name polypeptide GalNAc transferase 6 
 CG No CG2103  Old CG No CG2103 
 Synonyms CG2103, pgant6 
 Accession No (Link to NCBI)  
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGGCCTCGCTGCTCTTGTTG 
 Primer Seq. 3'
aatctagaggtaccGAATCCGAGAGCAGGGCATTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAAGGCCTCG CTGCTCTTGT TGATCTCACT GACTCTCTTC GTACTGATAA CCAGCTGGAT 
0061 CTCATCTACT CCGTACACCA ACAAGCCAGT CCATCATGGC GTGGAGCCCG TGCCCGAAAA 
0121 GGCTGGCCTT TCCGGCGATG TCAAGGTGAA GGTGCCAGCT ATAAAGCAAC CAGAACCTCA 
0181 GAAACCACAG GAACCCGACT TCGAAGAGGA TCCTGAGCTG CAGAAGATCG ATGAGCCCGA 
0241 ACCGGTGGAG GAAGAAGTCG ATAATCCGCA TCCGGCGGAC GACGAACCGC AACAGCAGCC 
0301 CCAGGAGGAG CTCCAAATGG CTGCGCCGGC GGACGCTTCG GTGAAGAAGG ACTGGCACGA 
0361 CTATACTTTC ATGGAAAAGG ATGCCAAGCG CGTGGGCCTC GGGGAGGGCG GAAAGGCATC 
0421 GACGCTCGAC GATGAGTCCC AGCGAGACTT GGAGAAGCGA ATGTCCCTGG AAAATGGATT 
0481 TAATGCCCTG CTCTCGGATT C 
 in silico PCR Fragment
0001 aaggcctcgc tgctcttgtt gatctcactg actctcttcg tactgataac cagctggatc 
0061 tcatctactc cgtacaccaa caagccagtc catcatggcg tggagcccgt gcccgaaaag 
0121 gctggccttt ccggcgatgt caaggtgaag gtgccagcta taaagcaacc agaacctcag 
0181 aaaccacagg aacccgactt cgaagaggat cctgagctgc agaagatcga tgagcccgaa 
0241 ccggtggagg aagaagtcga taatccgcat ccggcggacg acgaaccgca acagcagccc 
0301 caggaggagc tccaaatggc tgcgccggcg gacgcttcgg tgaagaagga ctggcacgac 
0361 tatactttca tggaaaagga tgccaagcgc gtgggcctcg gggagggcgg aaaggcatcg 
0421 acgctcgacg atgagtccca gcgagacttg gagaagcgaa tgtccctgga aaatggattt 
0481 aatgccctgc tctcggattc  
 Assemble Data

2103R-1.IR full       1   GAAGGCCTCGCTGCTCTTGTTGATCTCACTGACTCTCTTCGTACTGATAACCAGCTGGAT 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-1.in silico     1   -AAGGCCTCGCTGCTCTTGTTGATCTCACTGACTCTCTTCGTACTGATAACCAGCTGGAT 60


2103R-1.IR full       61  CTCATCTACTCCGTACACCAACAAGCCAGTCCATCATGGCGTGGAGCCCGTGCCCGAAAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-1.in silico     61  CTCATCTACTCCGTACACCAACAAGCCAGTCCATCATGGCGTGGAGCCCGTGCCCGAAAA 120


2103R-1.IR full       121 GGCTGGCCTTTCCGGCGATGTCAAGGTGAAGGTGCCAGCTATAAAGCAACCAGAACCTCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-1.in silico     121 GGCTGGCCTTTCCGGCGATGTCAAGGTGAAGGTGCCAGCTATAAAGCAACCAGAACCTCA 180


2103R-1.IR full       181 GAAACCACAGGAACCCGACTTCGAAGAGGATCCTGAGCTGCAGAAGATCGATGAGCCCGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-1.in silico     181 GAAACCACAGGAACCCGACTTCGAAGAGGATCCTGAGCTGCAGAAGATCGATGAGCCCGA 240


2103R-1.IR full       241 ACCGGTGGAGGAAGAAGTCGATAATCCGCATCCGGCGGACGACGAACCGCAACAGCAGCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-1.in silico     241 ACCGGTGGAGGAAGAAGTCGATAATCCGCATCCGGCGGACGACGAACCGCAACAGCAGCC 300


2103R-1.IR full       301 CCAGGAGGAGCTCCAAATGGCTGCGCCGGCGGACGCTTCGGTGAAGAAGGACTGGCACGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-1.in silico     301 CCAGGAGGAGCTCCAAATGGCTGCGCCGGCGGACGCTTCGGTGAAGAAGGACTGGCACGA 360


2103R-1.IR full       361 CTATACTTTCATGGAAAAGGATGCCAAGCGCGTGGGCCTCGGGGAGGGCGGAAAGGCATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-1.in silico     361 CTATACTTTCATGGAAAAGGATGCCAAGCGCGTGGGCCTCGGGGAGGGCGGAAAGGCATC 420


2103R-1.IR full       421 GACGCTCGACGATGAGTCCCAGCGAGACTTGGAGAAGCGAATGTCCCTGGAAAATGGATT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2103R-1.in silico     421 GACGCTCGACGATGAGTCCCAGCGAGACTTGGAGAAGCGAATGTCCCTGGAAAATGGATT 480


2103R-1.IR full       481 TAATGCCCTGCTCTCGGATTC 501
                          |||||||||||||||||||||
2103R-1.in silico     481 TAATGCCCTGCTCTCGGATTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_139492.2  polypeptide GalNAc transferase 6 CG2103-RA, transcript variant A (pgant6), mRNA 
100  482  NM_167966.1  polypeptide GalNAc transferase 6 CG2103-RB, transcript variant B (pgant6), mRNA 
NM_141246.1  CG14659-RA (CG14659), mRNA 
NM_142751.1  CG5778-RA (CG5778), mRNA 
NM_078865.2  Dorsal-related immunity factor CG6794-RA, transcript variant A (Dif), mRNA 
NM_165216.1  Dorsal-related immunity factor CG6794-RB, transcript variant B (Dif), mRNA 
NM_141333.2  CG2046-RA (CG2046), mRNA 
NM_139551.1  CG14961-RA (CG14961), mRNA 
10  NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
10  NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
NM_164575.1  CG3714-RE, transcript variant E (CG3714), mRNA 
NM_164572.1  CG3714-RA, transcript variant A (CG3714), mRNA 
NM_134974.4  CG3714-RB, transcript variant B (CG3714), mRNA 
NM_164573.1  CG3714-RC, transcript variant C (CG3714), mRNA 
NM_164574.1  CG3714-RD, transcript variant D (CG3714), mRNA 
15  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
13  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
NM_164381.1  Equilibrative nucleoside transporter 1 CG11907-RA, transcript variant A (Ent1), mRNA 
NM_134675.4  Equilibrative nucleoside transporter 1 CG11907-RB, transcript variant B (Ent1), mRNA 
NM_143722.2  ENL/AF9-related CG4913-RA (ear), mRNA 
NM_206769.1  CG9125-RA (CG9125), mRNA 
NM_080156.2  FK506-binding protein FKBP59 CG4535-RA (FKBP59), mRNA 
NM_142270.1  CG8927-RA, transcript variant A (CG8927), mRNA 
NM_001038967.1  CG8927-RB, transcript variant B (CG8927), mRNA 
NM_141723.1  CG6208-RA (CG6208), mRNA 
NM_164876.1  CG31711-RA (CG31711), mRNA 
NM_141237.1  CG14655-RA (CG14655), mRNA 
18  31  NM_164808.2  CG31901-RA (CG31901), mRNA 
NM_143516.2  CG15529-RA (CG15529), mRNA 
NM_139399.1  CG13921-RA, transcript variant A (CG13921), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.