National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2086R-1 
 Symbol drpr  Full Name draper 
 CG No CG2086  Old CG No CG2086 
 Synonyms BcDNA:GH03529, CG18172, CT41022, CT6730, CG2086, drpr, draper 
 Accession No (Link to NCBI) NM_058102.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Awasaki T, Tatsumi R, Takahashi K, Arai K, Nakanishi Y, Ueda R, Ito K.
Essential role of the apoptotic cell engulfment genes draper and ced-6 in programmed axon pruning during Drosophila metamorphosis.
Neuron (2006) 50(6) 855-67 [ PubMed ID = 16772168 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGGTAATCCTCATAGCCTGC 
 Primer Seq. 3'
aatctagaggtaccATGCCGTAGAATCCAGGTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 cCGGTAATCC TCATAGCCTG CCTGGTNCNA GCTGGTACTG GCTCAGGCGG ATCTTAAAGA 
0061 TCTGGATGGA CCCAATATCT GCAAAAGAAG AGAACTATAT AACGTAGACG TTGTCTACAC 
0121 AGAACTGCAA TCGTTCCAGG AACNGGGGCT CCACCTGGTG CGTCACATTC CCGCCGAGGT 
0181 GCTCCACCTA TCGCATTAAA CACCGAGTGG TCAACAAAAC CAAGNCGATT GNAAAGAACC 
0241 GTATTGTGAG GGACTGTTGT GATGGCTACA TCgCGAGCGC AGGAGAANGN GTGCCGCATT 
0301 GTTCGGAACC CTGCCAGCAC GGTAGATGCA TCTCCCCGGA GAAGTGCAAG TGTGATCATG 
0361 GTTACGGAGG ACCCGCCTGC GATATAATTT GCAGATGCCT GAATAACTCC TCCTGCGAcC 
0421 CCGATTCCGG TAACTGCATC TGCTCAGCNG GTANTGGACT GGCGcCGACT GTGCGGAACC 
0481 CTGCCCACCT GGATTCTACG NCAT 
 in silico PCR Fragment
0001 CCGGTAATCC TCATAGCCTG CCTGG-CCCA GCTGGTACTG GCTCAGGCGG ATCTTAAAGA 
0061 TCTGGATGGA CCCAATATCT GCAAAAGAAG AGAACTATAT AACGTAGACG TTGTCTACAC 
0121 AGAACTGCAA TCGTTCCAGG AAC-GGGGCT CCACCTGGTG CGTCACATTC CCGCCGAGGT 
0181 GCTCCACCTA TCGCATTAAA CACCGAGTGG TCAACAAAAC CAAGACGATT GCAAAGAACC 
0241 GTATTGTGAG GGACTGTTGT GATGGCTACA TCGCGAGCGC AGGAGAATGC GTGCCGCATT 
0301 GTTCGGAACC CTGCCAGCAC GGTAGATGCA TCTCCCCGGA GAAGTGCAAG TGTGATCATG 
0361 GTTACGGAGG ACCCGCCTGC GATATAATTT GCAGATGCCT GAATAACTCC TCCTGCGACC 
0421 CCGATTCCGG TAACTGCATC TGCTCAGCCG GT--TGGACT GGCGCCGACT GTGCGGAACC 
0481 CTGCCCACCT GGATTCTACG GCAT 
 Assemble Data

2086R-1.IR_full       1   CCGGTAATCCTCATAGCCTGCCTGGTNCNAGCTGGTACTGGCTCAGGCGGATCTTAAAGA 60
                          |||||||||||||||||||||||||  | |||||||||||||||||||||||||||||||
2086R-1.in silico     1   CCGGTAATCCTCATAGCCTGCCTGG-CCCAGCTGGTACTGGCTCAGGCGGATCTTAAAGA 60


2086R-1.IR_full       61  TCTGGATGGACCCAATATCTGCAAAAGAAGAGAACTATATAACGTAGACGTTGTCTACAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2086R-1.in silico     61  TCTGGATGGACCCAATATCTGCAAAAGAAGAGAACTATATAACGTAGACGTTGTCTACAC 120


2086R-1.IR_full       121 AGAACTGCAATCGTTCCAGGAACNGGGGCTCCACCTGGTGCGTCACATTCCCGCCGAGGT 180
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
2086R-1.in silico     121 AGAACTGCAATCGTTCCAGGAAC-GGGGCTCCACCTGGTGCGTCACATTCCCGCCGAGGT 180


2086R-1.IR_full       181 GCTCCACCTATCGCATTAAACACCGAGTGGTCAACAAAACCAAGNCGATTGNAAAGAACC 240
                          |||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||
2086R-1.in silico     181 GCTCCACCTATCGCATTAAACACCGAGTGGTCAACAAAACCAAGACGATTGCAAAGAACC 240


2086R-1.IR_full       241 GTATTGTGAGGGACTGTTGTGATGGCTACATCGCGAGCGCAGGAGAANGNGTGCCGCATT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||
2086R-1.in silico     241 GTATTGTGAGGGACTGTTGTGATGGCTACATCGCGAGCGCAGGAGAATGCGTGCCGCATT 300


2086R-1.IR_full       301 GTTCGGAACCCTGCCAGCACGGTAGATGCATCTCCCCGGAGAAGTGCAAGTGTGATCATG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2086R-1.in silico     301 GTTCGGAACCCTGCCAGCACGGTAGATGCATCTCCCCGGAGAAGTGCAAGTGTGATCATG 360


2086R-1.IR_full       361 GTTACGGAGGACCCGCCTGCGATATAATTTGCAGATGCCTGAATAACTCCTCCTGCGACC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2086R-1.in silico     361 GTTACGGAGGACCCGCCTGCGATATAATTTGCAGATGCCTGAATAACTCCTCCTGCGACC 420


2086R-1.IR_full       421 CCGATTCCGGTAACTGCATCTGCTCAGCNGGTANTGGACTGGCGCCGACTGTGCGGAACC 480
                          |||||||||||||||||||||||||||| |||  ||||||||||||||||||||||||||
2086R-1.in silico     421 CCGATTCCGGTAACTGCATCTGCTCAGCCGGT--TGGACTGGCGCCGACTGTGCGGAACC 480


2086R-1.IR_full       481 CTGCCCACCTGGATTCTACGNCAT 504
                          |||||||||||||||||||| |||
2086R-1.in silico     481 CTGCCCACCTGGATTCTACGGCAT 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058102.2  CG2086-RA, transcript variant A (drpr), mRNA 
20.12   97  NM_167911.1  CG2086-RB, transcript variant B (drpr), mRNA 
0   NM_136884.2  CG18343-RA (CG18343), mRNA 
0   20  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_141716.1  CG3925-RA (CG3925), mRNA 
0   NM_139523.1  CG12734-RA, transcript variant A (CG12734), mRNA 
0   NM_206262.1  CG12734-RB, transcript variant B (CG12734), mRNA 
0   NM_078737.2  CG16987-RA, transcript variant A (Alp23B), mRNA 
0   NM_132161.4  CG1659-RA (unc-119), mRNA 
0   NM_078614.3  CG8544-RB, transcript variant B (sd), mRNA 
0   NM_167465.1  CG8544-RA, transcript variant A (sd), mRNA 
0   NM_206727.1  CG8544-RC, transcript variant C (sd), mRNA 
0   NM_078575.2  CG9355-RA (dy), mRNA 
0   NM_001031957.1  CG33796-RA (CG33796), mRNA 
0   NM_145336.1  CG18107-RA (CG18107), mRNA 
0   NM_168478.1  CG32094-RA (CG32094), mRNA 
0   NM_001014613.2  CG17117-RE, transcript variant E (hth), mRNA 
0   NM_134975.2  CG3702-RA (CG3702), mRNA 
0   NM_135662.3  CG4970-RA, transcript variant A (CG4970), mRNA 
0   NM_135663.2  CG14929-RA, transcript variant A (CG14929), mRNA 
0   NM_137937.2  CG3502-RA (CG3502), mRNA 
0   NM_135833.2  CG16865-RA (CG16865), mRNA 
0   NM_001032082.1  CG4970-RB (CG4970), mRNA 
0   NM_001038801.1  CG5899-RC, transcript variant C (CG5899), mRNA 
0   NM_001038800.1  CG5899-RB, transcript variant B (CG5899), mRNA 
0   NM_135476.3  CG5899-RA, transcript variant A (CG5899), mRNA 
0   NM_167891.2  CG32313-RA (CG32313), mRNA 
0   NM_132029.3  CG15771-RA, transcript variant A (CG15771), mRNA 
0   NM_176687.2  CG15771-RB, transcript variant B (CG15771), mRNA 
0   NM_165073.1  CG31841-RA (CG31841), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.