National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2055R-2 
 Symbol Pkn  Full Name Protein kinase related to protein kinase N 
 CG No CG2049  Old CG No CG2055 
 Synonyms PKN, CG2049, Dpkn, dPKN, l(2)45Ca, l(2)06736, DPKN, 3-2, PRK2, CT6660, CT6637, CG2055, v(2)rG232, Pk?3, Pk45C, Pkn, Protein kinase-like 45C, Protein kinase related to protein kinase N, protein kinase N, protein kinase c related 
 Accession No (Link to NCBI) NM_176110.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Warner SJ, Longmore GD.
Distinct functions for Rho1 in maintaining adherens junctions and apical tension in remodeling epithelia.
J. Cell Biol. (2009) 185(6) 1111-25 [ PubMed ID = 19506041 ] [ RRC reference ]

Yashiro H, Loza AJ, Skeath JB, Longmore GD.
Rho1 regulates adherens junction remodeling by promoting recycling endosome formation through activation of myosin II.
Mol. Biol. Cell (2014) 25(19) 2956-69 [ PubMed ID = 25079692 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCATCCCGTTCTGTACGAGC 
 Primer Seq. 3'
aatctagaggtaccCTGGATCATGTTTTCCGCCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCATCCCGT TCTGTACGAG CTCAGTCACA AATATGGTTT CACAGAGAAT CTGCCGGAGA 
0061 GCTGTATGTC CATACGGCTG GAGGAGATCA AGGAGGCCAT TCGGCGAGAG ATCCGCAAGG 
0121 AGCTGAAGAT CAAAGAGGGC GCCGAGAAGC TCCGCGAGGT GGCTAAAGAT CGACGATCCC 
0181 TCAGCGATGT GGCCGTTCTT GTCAAGAAGA GCAAAAGTAA ACTTGCCGAG CTGAAGTCCG 
0241 AGTTGCAGGA GCTCGAGAGT CAAATCCTCC TGACATCGGC CAACACCGCC GTCAATAGTA 
0301 ATGGACAAGA ATCGATCACT GCCTGCATTG ATCCCAATGG CGGCTTCTTG GTCAGCGGTG 
0361 CAGTTGGTGG CTTGGGCGGT GGAAACACGG CTCTGGAGGG CGGCGCACCG GCCACTGCCA 
0421 ATGACAAAGT GCTCGCCTCG CTGGAGAAGC AGCTGCAGAT CGAGATGAAG GTGAAGACCG 
0481 GGGCGGAAAA CATGATCCAG  
 in silico PCR Fragment
0001 AGCATCCCGT TCTGTACGAG CTCAGTCACA AATATGGTTT CACAGAGAAT CTGCCGGAGA 
0061 GCTGTATGTC CATACGGCTG GAGGAGATCA AGGAGGCCAT TCGGCGAGAG ATCCGCAAGG 
0121 AGCTGAAGAT CAAAGAGGGC GCCGAGAAGC TCCGCGAGGT GGCTAAAGAT CGACGATCCC 
0181 TCAGCGATGT GGCCGTTCTT GTCAAGAAGA GCAAAAGTAA ACTTGCCGAG CTGAAGTCCG 
0241 AGTTGCAGGA GCTCGAGAGT CAAATCCTCC TGACATCGGC CAACACCGCC GTCAATAGTA 
0301 ATGGACAAGA ATCGATCACT GCCTGCATTG ATCCCAATGG CGGCTTCTTG GTCAGCGGTG 
0361 CAGTTGGTGG CTTGGGCGGC GGAAACACGG CTCTGGAGGG CGGCGCACCG GCCACTGCCA 
0421 ATGACAAAGT GCTCGCCTCG CTGGAGAAGC AGCTGCAGAT CGAGATGAAG GTGAAGACCG 
0481 GGGCGGAAAA CATGATCCAG  
 Assemble Data

2055R-2.IR_full       1   AGCATCCCGTTCTGTACGAGCTCAGTCACAAATATGGTTTCACAGAGAATCTGCCGGAGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2055R-2.in silico     1   AGCATCCCGTTCTGTACGAGCTCAGTCACAAATATGGTTTCACAGAGAATCTGCCGGAGA 60


2055R-2.IR_full       61  GCTGTATGTCCATACGGCTGGAGGAGATCAAGGAGGCCATTCGGCGAGAGATCCGCAAGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2055R-2.in silico     61  GCTGTATGTCCATACGGCTGGAGGAGATCAAGGAGGCCATTCGGCGAGAGATCCGCAAGG 120


2055R-2.IR_full       121 AGCTGAAGATCAAAGAGGGCGCCGAGAAGCTCCGCGAGGTGGCTAAAGATCGACGATCCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2055R-2.in silico     121 AGCTGAAGATCAAAGAGGGCGCCGAGAAGCTCCGCGAGGTGGCTAAAGATCGACGATCCC 180


2055R-2.IR_full       181 TCAGCGATGTGGCCGTTCTTGTCAAGAAGAGCAAAAGTAAACTTGCCGAGCTGAAGTCCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2055R-2.in silico     181 TCAGCGATGTGGCCGTTCTTGTCAAGAAGAGCAAAAGTAAACTTGCCGAGCTGAAGTCCG 240


2055R-2.IR_full       241 AGTTGCAGGAGCTCGAGAGTCAAATCCTCCTGACATCGGCCAACACCGCCGTCAATAGTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2055R-2.in silico     241 AGTTGCAGGAGCTCGAGAGTCAAATCCTCCTGACATCGGCCAACACCGCCGTCAATAGTA 300


2055R-2.IR_full       301 ATGGACAAGAATCGATCACTGCCTGCATTGATCCCAATGGCGGCTTCTTGGTCAGCGGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2055R-2.in silico     301 ATGGACAAGAATCGATCACTGCCTGCATTGATCCCAATGGCGGCTTCTTGGTCAGCGGTG 360


2055R-2.IR_full       361 CAGTTGGTGGCTTGGGCGGTGGAAACACGGCTCTGGAGGGCGGCGCACCGGCCACTGCCA 420
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
2055R-2.in silico     361 CAGTTGGTGGCTTGGGCGGCGGAAACACGGCTCTGGAGGGCGGCGCACCGGCCACTGCCA 420


2055R-2.IR_full       421 ATGACAAAGTGCTCGCCTCGCTGGAGAAGCAGCTGCAGATCGAGATGAAGGTGAAGACCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2055R-2.in silico     421 ATGACAAAGTGCTCGCCTCGCTGGAGAAGCAGCTGCAGATCGAGATGAAGGTGAAGACCG 480


2055R-2.IR_full       481 GGGCGGAAAACATGATCCAG 500
                          ||||||||||||||||||||
2055R-2.in silico     481 GGGCGGAAAACATGATCCAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176111.1  CG2049-RC, transcript variant C (Pkn), mRNA 
100   482  NM_176113.1  CG2049-RD, transcript variant D (Pkn), mRNA 
100   482  NM_176110.1  CG2049-RB, transcript variant B (Pkn), mRNA 
100   482  NM_176112.1  CG2049-RF, transcript variant F (Pkn), mRNA 
0   14  NM_132358.2  CG9686-RA (CG9686), mRNA 
0   12  NM_206518.1  CG4720-RB, transcript variant B (Pk92B), mRNA 
0   12  NM_057741.3  CG4720-RA, transcript variant A (Pk92B), mRNA 
0   NM_080257.2  CG6815-RA (bor), mRNA 
0   11  12  NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   11  12  NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_206089.1  CG33473-RB (luna), mRNA 
0   NM_142994.3  CG18528-RA (CG18528), mRNA 
0   10  NM_078878.2  CG10123-RA (Top3alpha), mRNA 
0   NM_079997.2  CG13580-RA (Crtp), mRNA 
0   NM_137836.1  CG12489-RA (Dnr1), mRNA 
0   10  NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   10  NM_136644.2  CG11804-RC, transcript variant C (ced-6), mRNA 
0   10  NM_165676.1  CG11804-RB, transcript variant B (ced-6), mRNA 
0   NM_130502.2  CG12311-RA (Pomt2), mRNA 
0   12  NM_080014.2  CG3064-RB (futsch), mRNA 
0   10  NM_133085.2  CG6606-RA (l(1)G0003), mRNA 
0   NM_079951.2  CG8269-RA (Dmn), mRNA 
0   NM_142950.1  CG5986-RA (CG5986), mRNA 
0   NM_079617.3  CG7855-RA (timeout), mRNA 
0   NM_080021.2  CG2952-RA (Dox-A3), mRNA 
0   NM_141552.2  CG11753-RA (CG11753), mRNA 
0   NM_132577.1  CG2556-RA (CG2556), mRNA 
0   NM_167890.1  CG7852-RB, transcript variant B (CG7852), mRNA 
0   NM_206232.1  CG7852-RC, transcript variant C (CG7852), mRNA 
0   NM_139363.1  CG7852-RA, transcript variant A (CG7852), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.