National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2055R-1 
 Symbol Pkn  Full Name Protein kinase related to protein kinase N 
 CG No CG2049  Old CG No CG2055 
 Synonyms PKN, CG2049, Dpkn, dPKN, l(2)45Ca, l(2)06736, DPKN, 3-2, PRK2, CT6660, CT6637, CG2055, v(2)rG232, Pk?3, Pk45C, Pkn, Protein kinase-like 45C, Protein kinase related to protein kinase N, protein kinase N, protein kinase c related 
 Accession No (Link to NCBI) NM_176110.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Warner SJ, Longmore GD.
Distinct functions for Rho1 in maintaining adherens junctions and apical tension in remodeling epithelia.
J Cell Biol (2009) 185(6) 1111-25 [ PubMed ID = 19506041 ] [ RRC reference ]

Yashiro H, Loza AJ, Skeath JB, Longmore GD.
Rho1 regulates adherens junction remodeling by promoting recycling endosome formation through activation of myosin II.
Mol Biol Cell (2014) 25(19) 2956-69 [ PubMed ID = 25079692 ] [ RRC reference ]

Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]

Hosono C, Matsuda R, Adryan B, Samakovlis C.
Transient junction anisotropies orient annular cell polarization in the Drosophila airway tubes.
Nat Cell Biol (2015) 17(12) 1569-76 [ PubMed ID = 26551273 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGCATCCCGTTCTGTACGAGCTCAGTCACAAATATGGTTTCACAGAGAATCTGCCGGAGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCTGTATGTCCATACGGCTGGAGGAGATCAAGGAGGCCATTCGGCGAGAGATCCGCAAGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGCTGAAGATCAAAGAGGGCGCCGAGAAGCTCCGCGAGGTGGCTAAAGATCGACGATCCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCAGCGATGTGGCCGTTCTTGTCAAGAAGAGCAAAAGTAAACTTGCCGAGCTGAAGTCCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGTTGCAGGAGCTCGAGAGTCAAATCCTCCTGACATCGGCCAACACCGCCGTCAATAGTA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATGGACAAGAATCGATCACTGCCTGCATTGATCCCAATGGCGGCTTCTTGGTCAGCGGTG 360

                          ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     361 CAGTTGGTGGCTTGGGCGGCGGAAACACGGCTCTGGAGGGCGGCGCACCGGCCACTGCCA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATGACAAAGTGCTCGCCTCGCTGGAGAAGCAGCTGCAGATCGAGATGAAGGTGAAGACCG 480

2055R-1.IR_full       481 GGGCGGAAAACATGATCCAG 500
                          |||||||||||||||||||| silico     481 GGGCGGAAAACATGATCCAG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176111.1  CG2049-RC, transcript variant C (Pkn), mRNA 
100   482  NM_176113.1  CG2049-RD, transcript variant D (Pkn), mRNA 
100   482  NM_176110.1  CG2049-RB, transcript variant B (Pkn), mRNA 
100   482  NM_176112.1  CG2049-RF, transcript variant F (Pkn), mRNA 
0   14  NM_132358.2  CG9686-RA (CG9686), mRNA 
0   12  NM_206518.1  CG4720-RB, transcript variant B (Pk92B), mRNA 
0   12  NM_057741.3  CG4720-RA, transcript variant A (Pk92B), mRNA 
0   NM_080257.2  CG6815-RA (bor), mRNA 
0   11  12  NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   11  12  NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_206089.1  CG33473-RB (luna), mRNA 
0   NM_142994.3  CG18528-RA (CG18528), mRNA 
0   10  NM_078878.2  CG10123-RA (Top3alpha), mRNA 
0   NM_079997.2  CG13580-RA (Crtp), mRNA 
0   NM_137836.1  CG12489-RA (Dnr1), mRNA 
0   10  NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0   10  NM_136644.2  CG11804-RC, transcript variant C (ced-6), mRNA 
0   10  NM_165676.1  CG11804-RB, transcript variant B (ced-6), mRNA 
0   NM_130502.2  CG12311-RA (Pomt2), mRNA 
0   12  NM_080014.2  CG3064-RB (futsch), mRNA 
0   10  NM_133085.2  CG6606-RA (l(1)G0003), mRNA 
0   NM_079951.2  CG8269-RA (Dmn), mRNA 
0   NM_142950.1  CG5986-RA (CG5986), mRNA 
0   NM_079617.3  CG7855-RA (timeout), mRNA 
0   NM_080021.2  CG2952-RA (Dox-A3), mRNA 
0   NM_141552.2  CG11753-RA (CG11753), mRNA 
0   NM_132577.1  CG2556-RA (CG2556), mRNA 
0   NM_167890.1  CG7852-RB, transcript variant B (CG7852), mRNA 
0   NM_206232.1  CG7852-RC, transcript variant C (CG7852), mRNA 
0   NM_139363.1  CG7852-RA, transcript variant A (CG7852), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.