National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2054R-1 
 Symbol Cht2  Full Name Chitinase 2 
 CG No CG2054  Old CG No CG2054 
 Synonyms CHT2, DmCHT2, CG2054, Cht2, cht2 
 Accession No (Link to NCBI) NM_057950.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nakaoka T, Iga M, Yamada T, Koujima I, Takeshima M, Zhou X, Suzuki Y, Ogihara MH, Kataoka H.
Deep sequencing of the prothoracic gland transcriptome reveals new players in insect ecdysteroidogenesis.
PLoS ONE (2017) 12(3) e0172951 [ PubMed ID = 28257485 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTGCCTATGCCATCGAGAAC 
 Primer Seq. 3'
aatctagaggtaccTAACGCGAGATCTGCCGCACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNTGCCTaTG CCATCGAGAA CTTCGACCCC AATTTGTGCA CCCATGTGGT GTACGCCTTT 
0061 GCCGGCCTGG ACATCACCCA GGCAGCCATC AAGTCGTTGG ATCCCTGGCA GGACCTAAAG 
0121 GAGGAGTACG GCAAGGGTGG CTACGAGAAA ATGACGGGTC TGAAAGCGCA GCCATCCGCA 
0181 TCTGAAGGTC AGCCTGGCCA TCGGCGGCTG GNAACGAGGG ATCGGCCAAC TACTCCACCC 
0241 TGGTGGCCAA CAATNCTGCT GCGCGGCAGG TTCGTCAAGC AGGTGTCCAG TTTCATACGC 
0301 AAGTACAACT TCGACGGGCT GGATCTCGAC TGGGAGTATC CCACGCAGCG GAAGGGCAAG 
0361 CCCGCNGGAT CGCGAGNAAC TTCGTTCTGC TGACCAAGGA GCTGCGCGAG GAGTTCGACG 
0421 AGCACGGCCT GCTGCTGACC TCCGCCATCG GAGCCTCCAA GAAGGTGATC GACGAGGCCT 
0481 ATGACGTGCG GCAGATNCTC GCGTTA 
 in silico PCR Fragment
0001 GGTGCCTATG CCATCGAGAA CTTCGACCCC AATTTGTGCA CCCATGTGGT GTACGCCTTT 
0061 GCCGGCCTGG ACATCACCCA GGCAGCCATC AAGTCGTTGG ATCCCTGGCA GGACCTAAAG 
0121 GAGGAGTACG GCAAGGGTGG CTACGAGAAA ATGACGGGTC TG-AAGCGCA GCCATCCGCA 
0181 TCTGAAGGTC AGCCTGGCCA TCGGCGGCTG G-AACGAGGG ATCGGCCAAC TACTCCACCC 
0241 TGGTGGCCAA CAAT-CTGCT GCGCGGCAGG TTCGTCAAGC AGGTGTCCAG TTTCATACGC 
0301 AAGTACAACT TCGACGGGCT GGATCTCGAC TGGGAGTATC CCACGCAGCG GAAGGGCAAG 
0361 CCCGC-GGAT CGCGAG-AAC TTCGTTCTGC TGACCAAGGA GCTGCGCGAG GAGTTCGACG 
0421 AGCACGGCCT GCTGCTGACC TCCGCCATCG GAGCCTCCAA GAAGGTGATC GACGAGGCCT 
0481 ATGACGTGCG GCAGAT-CTC GCGTTA 
 Assemble Data

2054R-1.IR_full       1   GNTGCCTATGCCATCGAGAACTTCGACCCCAATTTGTGCACCCATGTGGTGTACGCCTTT 60
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2054R-1.in silico     1   GGTGCCTATGCCATCGAGAACTTCGACCCCAATTTGTGCACCCATGTGGTGTACGCCTTT 60


2054R-1.IR_full       61  GCCGGCCTGGACATCACCCAGGCAGCCATCAAGTCGTTGGATCCCTGGCAGGACCTAAAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2054R-1.in silico     61  GCCGGCCTGGACATCACCCAGGCAGCCATCAAGTCGTTGGATCCCTGGCAGGACCTAAAG 120


2054R-1.IR_full       121 GAGGAGTACGGCAAGGGTGGCTACGAGAAAATGACGGGTCTGAAAGCGCAGCCATCCGCA 180
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
2054R-1.in silico     121 GAGGAGTACGGCAAGGGTGGCTACGAGAAAATGACGGGTCTG-AAGCGCAGCCATCCGCA 180


2054R-1.IR_full       181 TCTGAAGGTCAGCCTGGCCATCGGCGGCTGGNAACGAGGGATCGGCCAACTACTCCACCC 240
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
2054R-1.in silico     181 TCTGAAGGTCAGCCTGGCCATCGGCGGCTGG-AACGAGGGATCGGCCAACTACTCCACCC 240


2054R-1.IR_full       241 TGGTGGCCAACAATNCTGCTGCGCGGCAGGTTCGTCAAGCAGGTGTCCAGTTTCATACGC 300
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
2054R-1.in silico     241 TGGTGGCCAACAAT-CTGCTGCGCGGCAGGTTCGTCAAGCAGGTGTCCAGTTTCATACGC 300


2054R-1.IR_full       301 AAGTACAACTTCGACGGGCTGGATCTCGACTGGGAGTATCCCACGCAGCGGAAGGGCAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2054R-1.in silico     301 AAGTACAACTTCGACGGGCTGGATCTCGACTGGGAGTATCCCACGCAGCGGAAGGGCAAG 360


2054R-1.IR_full       361 CCCGCNGGATCGCGAGNAACTTCGTTCTGCTGACCAAGGAGCTGCGCGAGGAGTTCGACG 420
                          ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||
2054R-1.in silico     361 CCCGC-GGATCGCGAG-AACTTCGTTCTGCTGACCAAGGAGCTGCGCGAGGAGTTCGACG 420


2054R-1.IR_full       421 AGCACGGCCTGCTGCTGACCTCCGCCATCGGAGCCTCCAAGAAGGTGATCGACGAGGCCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2054R-1.in silico     421 AGCACGGCCTGCTGCTGACCTCCGCCATCGGAGCCTCCAAGAAGGTGATCGACGAGGCCT 480


2054R-1.IR_full       481 ATGACGTGCGGCAGATNCTCGCGTTA 506
                          |||||||||||||||| |||||||||
2054R-1.in silico     481 ATGACGTGCGGCAGAT-CTCGCGTTA 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057950.2  CG2054-RA (Cht2), mRNA 
0.62   NM_132074.1  CG3585-RA (CG3585), mRNA 
0.62   NM_142924.2  CG10219-RA (CG10219), mRNA 
0.41   NM_168239.1  CG17888-RC, transcript variant C (Pdp1), mRNA 
0.2   10  24  NM_137699.3  CG10531-RA (CG10531), mRNA 
0.2   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0.2   NM_140070.2  CG3424-RA, transcript variant A (path), mRNA 
0.2   NM_168349.1  CG3424-RC, transcript variant C (path), mRNA 
0   NM_143756.2  CG1548-RA (cathD), mRNA 
0   NM_136785.2  CG7712-RA (CG7712), mRNA 
0   NM_135771.2  CG9431-RA (kek4), mRNA 
0   NM_080223.2  CG3986-RA (Cht4), mRNA 
0   NM_168715.1  CG7930-RB, transcript variant B (TpnC73F), mRNA 
0   NM_079398.2  CG7930-RA, transcript variant A (TpnC73F), mRNA 
0   NM_079770.2  CG7748-RA (OstStt3), mRNA 
0   NM_137551.2  CG15117-RA, transcript variant A (CG15117), mRNA 
0   NM_166324.1  CG15117-RB, transcript variant B (CG15117), mRNA 
0   NM_001014535.1  CG15117-RC, transcript variant C (CG15117), mRNA 
0   NM_132133.1  CG3044-RA (CG3044), mRNA 
0   NM_137698.1  CG9357-RA (CG9357), mRNA 
0   NM_167908.1  CG7961-RB, transcript variant B (alphaCop), mRNA 
0   NM_058047.3  CG7961-RA, transcript variant A (alphaCop), mRNA 
0   NM_165747.2  CG4001-RC, transcript variant C (Pfk), mRNA 
0   NM_165746.1  CG4001-RB, transcript variant B (Pfk), mRNA 
0   NM_078952.2  CG4001-RA, transcript variant A (Pfk), mRNA 
0   NM_167080.1  CG32742-RA (l(1)G0148), mRNA 
0   12  NM_176385.1  CG33214-RA (CG33214), mRNA 
0   11  NM_132216.2  CG2116-RA (CG2116), mRNA 
0   NM_079447.3  CG8363-RE, transcript variant E (Paps), mRNA 
0   NM_168824.2  CG8363-RD, transcript variant D (Paps), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.