National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1954R-1 
 Symbol Pkc98E  Full Name Protein C kinase 98E 
 CG No CG1954  Old CG No CG1954 
 Synonyms PKC-98F, PKC, PKC 98F, CG1954, 98F, dPKC98F, Dpkc3, PKC d98F, nPKC, Pkc3, Nc98F, Pkc98E 
 Accession No (Link to NCBI) NM_079821.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hasygar K, Hietakangas V.
p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.
PLoS Genet. (2014) 10(11) e1004764 [ PubMed ID = 25393288 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGACTTCCAGAAGCGCCACAA 
 Primer Seq. 3'
aatctagaggtaccGACGCAAAAACGTGGCCATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGACTTCCAG AAGCGCCACA ATCTCACCTT CGGCAAACTG GCCGACGAGC AGCTCATCGA 
0061 CCCCTATGTC TCCATAGATG TCGACGAGAG TCACTTCGAT CGAGCCACCA CGCGGCCAAA 
0121 GACATTCGAT CCTGTTTGGA ACGAGCAGTT CGTCCACGAC GTGACCAATG TGAGCAACAT 
0181 CAACTTGACC GTCTTTCATG ATGCTGCTCT GCCGCCGGAT GACTTTGTGG CCAACTGCAT 
0241 CATCTCCTTC GAGGACCTCA TGCAGAGCGA GACGGCTGTG CAGGATCTAT GGGTTAACTT 
0301 GGAGCCGCAA GGCAAGATTC ACGTCATCAT TGAGCTAAAG AATCGCACGG ATAAAGCCAA 
0361 AGCCGAGGCC GTGGTGGAGC ACACCGTGGC CGTCAACAAG GAGTTCAAAG AGCGCGCCGG 
0421 ATTCAACCGA CGTCGCGGTG CCATGCGTCG TCGGGTCCAT CAGGTGAATG GGCACAAGTT 
0481 CATGGCCACG TTTTTGCGTC  
 in silico PCR Fragment
0001 AGACTTCCAG AAGCGCCACA ATCTCACCTT CGGCAAACTG GCCGACGAGC AGCTCATCGA 
0061 CCCCTATGTC TCCATAGATG TCGACGAGAG TCACTTCGAT CGAGCCACCA CGCGGCCAAA 
0121 GACATTCGAT CCTGTTTGGA ACGAGCAGTT CGTCCACGAC GTGACCAATG TGAGCAACAT 
0181 CAACTTGACC GTCTTTCATG ATGCTGCTCT GCCGCCGGAT GACTTTGTGG CCAACTGCAT 
0241 CATCTCCTTC GAGGACCTCA TGCAGAGCGA GACGGCTGTG CAGGATCTAT GGGTTAACTT 
0301 GGAGCCGCAA GGCAAGATTC ACGTCATCAT TGAGCTAAAG AATCGCACGG ATAAAGCCAA 
0361 AGCCGAGGCC GTGGTGGAGC ACACCGTGGC CGTCAACAAG GAGTTCAAAG AGCGCGCCGG 
0421 ATTCAACCGA CGTCGCGGTG CCATGCGTCG TCGGGTCCAT CAGGTGAATG GGCACAAGTT 
0481 CATGGCCACG TTTTTGCGTC  
 Assemble Data

1954R-1.IR_full       1   AGACTTCCAGAAGCGCCACAATCTCACCTTCGGCAAACTGGCCGACGAGCAGCTCATCGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1954R-1.in silico     1   AGACTTCCAGAAGCGCCACAATCTCACCTTCGGCAAACTGGCCGACGAGCAGCTCATCGA 60


1954R-1.IR_full       61  CCCCTATGTCTCCATAGATGTCGACGAGAGTCACTTCGATCGAGCCACCACGCGGCCAAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1954R-1.in silico     61  CCCCTATGTCTCCATAGATGTCGACGAGAGTCACTTCGATCGAGCCACCACGCGGCCAAA 120


1954R-1.IR_full       121 GACATTCGATCCTGTTTGGAACGAGCAGTTCGTCCACGACGTGACCAATGTGAGCAACAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1954R-1.in silico     121 GACATTCGATCCTGTTTGGAACGAGCAGTTCGTCCACGACGTGACCAATGTGAGCAACAT 180


1954R-1.IR_full       181 CAACTTGACCGTCTTTCATGATGCTGCTCTGCCGCCGGATGACTTTGTGGCCAACTGCAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1954R-1.in silico     181 CAACTTGACCGTCTTTCATGATGCTGCTCTGCCGCCGGATGACTTTGTGGCCAACTGCAT 240


1954R-1.IR_full       241 CATCTCCTTCGAGGACCTCATGCAGAGCGAGACGGCTGTGCAGGATCTATGGGTTAACTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1954R-1.in silico     241 CATCTCCTTCGAGGACCTCATGCAGAGCGAGACGGCTGTGCAGGATCTATGGGTTAACTT 300


1954R-1.IR_full       301 GGAGCCGCAAGGCAAGATTCACGTCATCATTGAGCTAAAGAATCGCACGGATAAAGCCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1954R-1.in silico     301 GGAGCCGCAAGGCAAGATTCACGTCATCATTGAGCTAAAGAATCGCACGGATAAAGCCAA 360


1954R-1.IR_full       361 AGCCGAGGCCGTGGTGGAGCACACCGTGGCCGTCAACAAGGAGTTCAAAGAGCGCGCCGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1954R-1.in silico     361 AGCCGAGGCCGTGGTGGAGCACACCGTGGCCGTCAACAAGGAGTTCAAAGAGCGCGCCGG 420


1954R-1.IR_full       421 ATTCAACCGACGTCGCGGTGCCATGCGTCGTCGGGTCCATCAGGTGAATGGGCACAAGTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1954R-1.in silico     421 ATTCAACCGACGTCGCGGTGCCATGCGTCGTCGGGTCCATCAGGTGAATGGGCACAAGTT 480


1954R-1.IR_full       481 CATGGCCACGTTTTTGCGTC 500
                          ||||||||||||||||||||
1954R-1.in silico     481 CATGGCCACGTTTTTGCGTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079821.2  CG1954-RA (Pkc98E), mRNA 
0.62   NM_079811.2  CG5583-RA (Ets98B), mRNA 
0.62   NM_166295.1  CG15069-RB, transcript variant B (Rgk2), mRNA 
0.62   NM_137498.1  CG15069-RA, transcript variant A (Rgk2), mRNA 
0.2   NM_139880.2  CG7526-RA, transcript variant A (CG7526), mRNA 
0.2   NM_206292.1  CG7526-RB, transcript variant B (CG7526), mRNA 
0   NM_168833.1  CG6933-RB, transcript variant B (CG6933), mRNA 
0   NM_168834.1  CG6933-RC, transcript variant C (CG6933), mRNA 
0   NM_140934.1  CG6933-RA, transcript variant A (CG6933), mRNA 
0   NM_143158.1  CG4743-RA (CG4743), mRNA 
0   NM_132635.1  CG4187-RA (CG4187), mRNA 
0   NM_057380.2  CG8355-RA, transcript variant A (sli), mRNA 
0   NM_057381.2  CG8355-RB, transcript variant B (sli), mRNA 
0   NM_057379.2  CG8355-RC, transcript variant C (sli), mRNA 
0   NM_141285.1  CG14670-RA (CG14670), mRNA 
0   NM_132560.2  CG1924-RA (CG1924), mRNA 
0   NM_166535.1  CG4444-RA (px), mRNA 
0   NM_079476.2  CG5683-RB, transcript variant B (Aef1), mRNA 
0   NM_168904.2  CG5683-RC, transcript variant C (Aef1), mRNA 
0   NM_168903.2  CG5683-RA, transcript variant A (Aef1), mRNA 
0   NM_165131.2  CG31826-RA (CG31826), mRNA 
0   NM_136220.1  CG9333-RA (Oseg5), mRNA 
0   NM_140618.1  CG13040-RA (CG13040), mRNA 
0   NM_176436.1  CG8176-RB, transcript variant B (CG8176), mRNA 
0   NM_176435.1  CG8176-RA, transcript variant A (CG8176), mRNA 
0   NM_132097.1  CG3950-RA (CG3950), mRNA 
0   NM_167279.1  CG18361-RB, transcript variant B (dsh), mRNA 
0   NM_078563.2  CG18361-RA, transcript variant A (dsh), mRNA 
0   NM_170652.1  CG6643-RA, transcript variant A (CG6643), mRNA 
0   NM_170653.1  CG6643-RB, transcript variant B (CG6643), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.