National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1950R-1 
 Symbol CG1950  Full Name CG1950 
 CG No CG1950  Old CG No CG1950 
 Synonyms CG1950 
 Accession No (Link to NCBI) NM_132553.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Fernández-Espartero CH, Rizzo A, Fulford AD, Falo-Sanjuan J, Goutte-Gattat D, Ribeiro PS.
Prp8 regulates oncogene-induced hyperplastic growth in Drosophila.
Development (2018) 145(22) [ PubMed ID = 30333215 ] [ RRC reference ]

Zhang J, Liu M, Su Y, Du J, Zhu AJ.
A targeted in vivo RNAi screen reveals deubiquitinases as new regulators of Notch signaling.
G3 (Bethesda) (2012) 2(12) 1563-75 [ PubMed ID = 23275879 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACCCGAACTCTTCGTGGTTG 
 Primer Seq. 3'
aatctagaggtaccGACCGATCCTTGGCCTTGTCA 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 NACCCGAACT CTTCGTGGTT GAAGAGAGCA CGGATTTCAT AGAAGATGAT TGTTACCACT 
0061 TTGTGGGCTT TATGCCAATA AAAGGCAAAC TTTTCGAATT GGACGGAATG CATGAGGGTC 
0121 CCATCGAACT GGCCGATATC GACCAGCAAC AGAACTGGCT GGATGTGGTC AGACCGATTA 
0181 TTGAGGCACG CATGGAANGC TACAGCGTCG GTGAGATCCA CTTCAATCTA ATGGCCCTGG 
0241 TCTCGGATCG TCAGCGATGC TACGAGCGGA AGATCCAAAT GCTGGTCAAC CTACCATCGC 
0301 AACNAAGCCA CNCGGATCGT CAGGCGGAGA TCGCCAACCT AAGATCCCAT GTGAGGCACG 
0361 AGAAGGAGAA GAAGCGTcGC TNTCGCAAGG AGAACATTCG TCGCCGCCAC AATTATCTGC 
0421 CCTTCATTGT TGAGCTACTA AAGCAGCTGG GCGAGACTGG CCAATTGATG GCCATTTGTG 
0481 ACAAGGCCAA GGATCGGTC 
 in silico PCR Fragment
0001 GACCCGAACT CTTCGTGGTT GAAGAGAGCA CGGATTTCAT AGAAGATGAT TGTTACCACT 
0061 TTGTGGGCTT TATGCCAATA AAAGGCAAAC TTTTCGAATT GGACGGAATG CATGAGGGTC 
0121 CCATCGAACT GGCCGATATC GACCAGCAAC AGAACTGGCT GGATGTGGTC AGACCGATTA 
0181 TTGAGGCACG CATGGAACGC TACAGCGTCG GTGAGATCCA CTTCAATCTA ATGGCCCTGG 
0241 TCTCGGATCG TCAGCGATGC TACGAGCGGA AGATCCAAAT GCTGGTCAAC CTACCATCGC 
0301 AACTAAGCCA CGCGGATCGT CAGGCGGAGA TCGCCAACCT AAGATCCCAT GTGAGGCACG 
0361 AGAAGGAGAA GAAGCGTCGC TATCGCAAGG AGAACATTCG TCGCCGCCAC AATTATCTGC 
0421 CCTTCATTGT TGAGCTACTA AAGCAGCTGG GCGAGACTGG CCAATTGATG GCCATTTGTG 
0481 ACAAGGCCAA GGATCGGTC 
 Assemble Data

1950R-1.IR_full        1   ACCCGAACTCTTCGTGGTTGAAGAGAGCACGGATTTCATAGAAGATGATTGTTACCACT 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1950R-1.in silico      1   ACCCGAACTCTTCGTGGTTGAAGAGAGCACGGATTTCATAGAAGATGATTGTTACCACT 59


1950R-1.IR_full       61  TTGTGGGCTTTATGCCAATAAAAGGCAAACTTTTCGAATTGGACGGAATGCATGAGGGTC 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1950R-1.in silico     61  TTGTGGGCTTTATGCCAATAAAAGGCAAACTTTTCGAATTGGACGGAATGCATGAGGGTC 119


1950R-1.IR_full       121 CCATCGAACTGGCCGATATCGACCAGCAACAGAACTGGCTGGATGTGGTCAGACCGATTA 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1950R-1.in silico     121 CCATCGAACTGGCCGATATCGACCAGCAACAGAACTGGCTGGATGTGGTCAGACCGATTA 179


1950R-1.IR_full       181 TTGAGGCACGCATGGAANGCTACAGCGTCGGTGAGATCCACTTCAATCTAATGGCCCTGG 239
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
1950R-1.in silico     181 TTGAGGCACGCATGGAACGCTACAGCGTCGGTGAGATCCACTTCAATCTAATGGCCCTGG 239


1950R-1.IR_full       241 TCTCGGATCGTCAGCGATGCTACGAGCGGAAGATCCAAATGCTGGTCAACCTACCATCGC 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1950R-1.in silico     241 TCTCGGATCGTCAGCGATGCTACGAGCGGAAGATCCAAATGCTGGTCAACCTACCATCGC 299


1950R-1.IR_full       301 AACNAAGCCACNCGGATCGTCAGGCGGAGATCGCCAACCTAAGATCCCATGTGAGGCACG 359
                          ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
1950R-1.in silico     301 AACTAAGCCACGCGGATCGTCAGGCGGAGATCGCCAACCTAAGATCCCATGTGAGGCACG 359


1950R-1.IR_full       361 AGAAGGAGAAGAAGCGTCGCTNTCGCAAGGAGAACATTCGTCGCCGCCACAATTATCTGC 419
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
1950R-1.in silico     361 AGAAGGAGAAGAAGCGTCGCTATCGCAAGGAGAACATTCGTCGCCGCCACAATTATCTGC 419


1950R-1.IR_full       421 CCTTCATTGTTGAGCTACTAAAGCAGCTGGGCGAGACTGGCCAATTGATGGCCATTTGTG 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1950R-1.in silico     421 CCTTCATTGTTGAGCTACTAAAGCAGCTGGGCGAGACTGGCCAATTGATGGCCATTTGTG 479


1950R-1.IR_full       481 ACAAGGCCAAGGATCGGTC 498
                          |||||||||||||||||||
1950R-1.in silico     481 ACAAGGCCAAGGATCGGTC 498

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_132553.1  CG1950-RA (CG1950), mRNA 
0   30  43  NM_079279.2  CG3431-RA (Uch-L3), mRNA 
0   NM_165009.1  CG31763-RA (CG31763), mRNA 
0   NM_168856.1  CG18803-RB, transcript variant B (Psn), mRNA 
0   NM_079460.2  CG18803-RA, transcript variant A (Psn), mRNA 
0   NM_143428.2  CG14514-RA (Brd8), mRNA 
0   NM_134689.1  CG2794-RA (CG2794), mRNA 
0   NM_078772.2  CG13772-RA (neuroligin), mRNA 
0   NM_165154.1  CG31818-RA (CG31818), mRNA 
0   NM_057760.4  CG12245-RA (gcm), mRNA 
0   NM_130688.2  CG14423-RA (CG14423), mRNA 
0   NM_078615.3  CG9045-RA, transcript variant A (Myb), mRNA 
0   NM_206734.1  CG9045-RB, transcript variant B (Myb), mRNA 
0   NM_206733.1  CG9045-RD, transcript variant D (Myb), mRNA 
0   NM_206732.1  CG9045-RC, transcript variant C (Myb), mRNA 
0   NM_206731.1  CG9045-RE, transcript variant E (Myb), mRNA 
0   NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_137624.1  CG9090-RA (CG9090), mRNA 
0   NM_078590.2  CG1771-RB, transcript variant B (mew), mRNA 
0   NM_167354.1  CG1771-RA, transcript variant A (mew), mRNA 
0   NM_169275.1  CG8874-RC, transcript variant C (Fps85D), mRNA 
0   NM_169274.1  CG8874-RB, transcript variant B (Fps85D), mRNA 
0   NM_079564.3  CG8874-RA, transcript variant A (Fps85D), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_058067.2  CG6147-RA (Tsc1), mRNA 
0   NM_135772.1  CG9426-RA (CG9426), mRNA 
0   NM_139392.1  CG7991-RA (CG7991), mRNA 
0   NM_057601.2  CG2851-RA (Gsc), mRNA 
0   NM_136557.2  CG8635-RA (CG8635), mRNA 
0   NM_080707.2  CG3430-RA (CG3430), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.