National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1901R-3 
 Symbol mav  Full Name maverick 
 CG No CG1901  Old CG No CG1901 
 Synonyms Mav, TGF-b, CG1901, mav 
 Accession No (Link to NCBI) NM_079887.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hevia CF, de Celis JF.
Activation and function of TGFβ signalling during Drosophila wing development and its interactions with the BMP pathway.
Dev. Biol. (2013) 377(1) 138-53 [ PubMed ID = 23485686 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACCTCCTTGCAAACATCCGC 
 Primer Seq. 3'
aatctagaggtaccGATATCCCTAGTTTCCCTCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AACCTCCTTG CAAACATCCG CCTATTACTG ATAATGCTGA GGCTAAGCTC ACCCTAGTTT 
0061 GTAGTAGGTC ACTAAAGCTT TACAAAATAT GGTTTATATT GATTTTATTG ATGTCAACTC 
0121 AGCATCAAGT CAGAGGCCAT GGCATATTCC GCCAAACGTC AAGTTCAAAA GCAGTATTTT 
0181 CATACTATCA GCCTAAAGAA AATATTACAT TTACCAATTT GCAGCTTCAA AATTTAGAAA 
0241 ATGAAGCTAA GAGACTAGAA ACAAATCAAC ATCCAATAAT CCGAGCCAAA TCAACTCCGA 
0301 AAATGGGTCT TAAAAATGTA TTTGAAAGCT TTAGCAAACA AAGCAGAGAC TCAATCTACA 
0361 ATGCCAGTTC AAATAAATAT AGTCTGATTA ATGTAAGCCA GTCAAAAAAC TTTCCTCAAT 
0421 TATTCAATAA AAAATTGTCA GTTCAGTGGA TAAACACCGT ACCAATTCAA AGTAGGCAAA 
0481 CGAGGGAAAC TAGGGATATC  
 in silico PCR Fragment
0001 AACCTCCTTG CAAACATCCG CCTATTACTG ATAATGCTGA GGCTAAGCTC ACCCTAGTTT 
0061 GTAGTAGGTC ACTAAAGCTT TACAAAATAT GGTTTATATT GATTTTATTG ATGTCAACTC 
0121 AGCATCAAGT CAGTGGCCAT GGCATATTCC GCCAAACGTC AAGTTCAAAA GCAGTATTTT 
0181 CATACTATCA GCCTAAAGAA AATATTACAT TTACCAATTT GCAGCTTCAA AATTTAGAAA 
0241 ATGAAGCTAA GAGACTAGAA ACAAATCAAC ATCCAATAAT CCGAGCCAAA TCAACTCCGA 
0301 AAATGGGTCT TAAAAATGTA TTTGAAAGCT TTAGCAAACA AAGCAGAGAC TCAATCTACA 
0361 ATGCCAGTTC AAATAAATAT AGTCTGATTA ATGTAAGCCA GTCAAAAAAC TTTCCTCAAT 
0421 TATTCAATAA AAAATTGTCA GTTCAGTGGA TAAACACCGT ACCAATTCAA AGTAGGCAAA 
0481 CGAGGGAAAC TAGGGATATC  
 Assemble Data

1901R-3.IR_full       1   AACCTCCTTGCAAACATCCGCCTATTACTGATAATGCTGAGGCTAAGCTCACCCTAGTTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1901R-3.in silico     1   AACCTCCTTGCAAACATCCGCCTATTACTGATAATGCTGAGGCTAAGCTCACCCTAGTTT 60


1901R-3.IR_full       61  GTAGTAGGTCACTAAAGCTTTACAAAATATGGTTTATATTGATTTTATTGATGTCAACTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1901R-3.in silico     61  GTAGTAGGTCACTAAAGCTTTACAAAATATGGTTTATATTGATTTTATTGATGTCAACTC 120


1901R-3.IR_full       121 AGCATCAAGTCAGAGGCCATGGCATATTCCGCCAAACGTCAAGTTCAAAAGCAGTATTTT 180
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
1901R-3.in silico     121 AGCATCAAGTCAGTGGCCATGGCATATTCCGCCAAACGTCAAGTTCAAAAGCAGTATTTT 180


1901R-3.IR_full       181 CATACTATCAGCCTAAAGAAAATATTACATTTACCAATTTGCAGCTTCAAAATTTAGAAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1901R-3.in silico     181 CATACTATCAGCCTAAAGAAAATATTACATTTACCAATTTGCAGCTTCAAAATTTAGAAA 240


1901R-3.IR_full       241 ATGAAGCTAAGAGACTAGAAACAAATCAACATCCAATAATCCGAGCCAAATCAACTCCGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1901R-3.in silico     241 ATGAAGCTAAGAGACTAGAAACAAATCAACATCCAATAATCCGAGCCAAATCAACTCCGA 300


1901R-3.IR_full       301 AAATGGGTCTTAAAAATGTATTTGAAAGCTTTAGCAAACAAAGCAGAGACTCAATCTACA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1901R-3.in silico     301 AAATGGGTCTTAAAAATGTATTTGAAAGCTTTAGCAAACAAAGCAGAGACTCAATCTACA 360


1901R-3.IR_full       361 ATGCCAGTTCAAATAAATATAGTCTGATTAATGTAAGCCAGTCAAAAAACTTTCCTCAAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1901R-3.in silico     361 ATGCCAGTTCAAATAAATATAGTCTGATTAATGTAAGCCAGTCAAAAAACTTTCCTCAAT 420


1901R-3.IR_full       421 TATTCAATAAAAAATTGTCAGTTCAGTGGATAAACACCGTACCAATTCAAAGTAGGCAAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1901R-3.in silico     421 TATTCAATAAAAAATTGTCAGTTCAGTGGATAAACACCGTACCAATTCAAAGTAGGCAAA 480


1901R-3.IR_full       481 CGAGGGAAACTAGGGATATC 500
                          ||||||||||||||||||||
1901R-3.in silico     481 CGAGGGAAACTAGGGATATC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   433  NM_001014690.1  CG1901-RB, transcript variant B (mav), mRNA 
95.84   415  NM_079887.2  CG1901-RA, transcript variant A (mav), mRNA 
0   NM_135424.3  CG13102-RA (CG13102), mRNA 
0   NM_206343.1  CG5620-RB, transcript variant B (CG5620), mRNA 
0   NM_140304.2  CG5620-RA, transcript variant A (CG5620), mRNA 
0   NM_132741.1  CG5334-RA (CG5334), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_079601.2  CG11502-RB, transcript variant B (svp), mRNA 
0   NM_169458.1  CG11502-RA, transcript variant A (svp), mRNA 
0   NM_132247.2  CG11190-RA (CG11190), mRNA 
0   NM_001038982.1  CG33970-RA, transcript variant A (CG33970), mRNA 
0   NM_165607.1  CG2127-RB, transcript variant B (CG2127), mRNA 
0   NM_136531.2  CG2127-RA, transcript variant A (CG2127), mRNA 
0   NM_139852.2  CG8591-RA (CTCF), mRNA 
0   NM_140943.2  CG32227-RA (CG32227), mRNA 
0   NM_001015233.1  CG40153-PA.3 (CG40153), mRNA 
0   NM_135068.2  CG10833-RA (Cyp28d1), mRNA 
0   NM_141333.2  CG2046-RA (CG2046), mRNA 
0   11  NM_057638.3  CG14472-RA (poe), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_001015349.1  CG40080-PA.3 (CG40080), mRNA 
0   NM_205873.1  CG1710-RD, transcript variant D (Hcf), mRNA 
0   NM_079882.2  CG1710-RA, transcript variant A (Hcf), mRNA 
0   NM_166756.1  CG1710-RB, transcript variant B (Hcf), mRNA 
0   NM_166757.1  CG1710-RC, transcript variant C (Hcf), mRNA 
0   NM_057804.2  CG1451-RA (Apc), mRNA 
0   NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
0   NM_001015501.1  CG17629-PD.3 (CG17629), mRNA 
0   NM_167408.1  CG32600-RA (dpr8), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.