National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18802R-4 
 Symbol alpha-Man-II  Full Name alpha Mannosidase II 
 CG No CG18802  Old CG No CG18802 
 Synonyms dGMII, GMII, DM-GII.1, GmII, MAN-2, alpha-Man-II, CG8139, CG18474, CG18802, Man 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGGCGGTTCGCTTTGGTAAT 
 Primer Seq. 3'
aatctagaggtaccGCTTGGTGTCGTGCTGGTAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

18802R-4.IR full       1   ------------TTTGGTAATTTGCTCCGGCTGCCTGCTGGTTTTCCTCAGCCTGTACAT 60
                                       ||||||||||||||||||||||||||||||||||||||||||||||||
18802R-4.in silico     1   TCGGCGGTTCGCTTTGGTAATTTGCTCCGGCTGCCTGCTGGTTTTCCTCAGCCTGTACAT 60


18802R-4.IR full       61  AATCCTCAATTTTGCGGCGCCGGCAGCCACCCAGATAAAGCCCAACTATGAGAACATTGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-4.in silico     61  AATCCTCAATTTTGCGGCGCCGGCAGCCACCCAGATAAAGCCCAACTATGAGAACATTGA 120


18802R-4.IR full       121 GAACAAGCTGCATGAGCTGGAAAATGGTTTGCAGGAGCACGGGGAGGAGATGCGGAATCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-4.in silico     121 GAACAAGCTGCATGAGCTGGAAAATGGTTTGCAGGAGCACGGGGAGGAGATGCGGAATCT 180


18802R-4.IR full       181 CAGGGCGCGTCTGGCCAAAACATCCAATCGCGACGATCCAATAAGACCTCCACTTAAAGT 240
                           |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||
18802R-4.in silico     181 CAGGGCGCGTCTTGCCGAAACATCCAATCGCGACGATCCAATAAGACCTCCACTTAAAGT 240


18802R-4.IR full       241 GGCTCGTTCCCCGAGGCCAGGGCAATGCCAAGATGTGGTCCAAGACGTGCCCAATGTGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-4.in silico     241 GGCTCGTTCCCCGAGGCCAGGGCAATGCCAAGATGTGGTCCAAGACGTGCCCAATGTGGA 300


18802R-4.IR full       301 TGTACAGATGCTGGAGCTATACGATCGCATGTCCTTCAAGGACATAGATGGAGGCGTGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-4.in silico     301 TGTACAGATGCTGGAGCTATACGATCGCATGTCCTTCAAGGACATAGATGGAGGCGTGTG 360


18802R-4.IR full       361 GAAACAGGGCTGGAACATTAAGTACGATCCACTGAAGTACAACGCCCATCACAAACTAAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-4.in silico     361 GAAACAGGGCTGGAACATTAAGTACGATCCACTGAAGTACAACGCCCATCACAAACTAAA 420


18802R-4.IR full       421 AGTCTTGTTTGTGCCGCACTCGCACAACGATCCTGGATGGATTCAGACGTTTGAGGAATA 480
                           ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-4.in silico     421 AGTCTTCGTTGTGCCGCACTCGCACAACGATCCTGGATGGATTCAGACGTTTGAGGAATA 480


18802R-4.IR full       481 CTACCAGCACGACACCA--- 500
                           |||||||||||||||||   
18802R-4.in silico     481 CTACCAGCACGACACCAAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079567.2  alpha Mannosidase II CG18802-RA (alpha-Man-II), mRNA 
NM_166326.1  CG15118-RC, transcript variant C (CG15118), mRNA 
NM_166327.1  CG15118-RD, transcript variant D (CG15118), mRNA 
NM_137552.2  CG15118-RB, transcript variant B (CG15118), mRNA 
NM_166325.1  CG15118-RA, transcript variant A (CG15118), mRNA 
NM_141653.2  CG16789-RA (CG16789), mRNA 
NM_140229.2  CG7351-RA (CG7351), mRNA 
NM_141775.1  CG14695-RA (CG14695), mRNA 
NM_141394.2  CG10284-RA (CG10284), mRNA 
NM_166629.1  Upf3 CG11184-RB, transcript variant B (Upf3), mRNA 
NM_138000.2  Upf3 CG11184-RC, transcript variant C (Upf3), mRNA 
NM_206102.1  Cap-G CG17054-RE, transcript variant E (Cap-G), mRNA 
NM_206105.1  Cap-G CG17054-RB, transcript variant B (Cap-G), mRNA 
NM_136995.2  Cap-G CG17054-RA, transcript variant A (Cap-G), mRNA 
NM_206104.1  Cap-G CG17054-RC, transcript variant C (Cap-G), mRNA 
NM_206103.1  Cap-G CG17054-RD, transcript variant D (Cap-G), mRNA 
NM_079453.2  gigas CG6975-RA (gig), mRNA 
NM_136412.2  polypeptide GalNAc transferase 3 CG4445-RA (pgant3), mRNA 
11  NM_142237.2  alpha-Man-IIb CG4606-RA (alpha-Man-IIb), mRNA 
NM_133101.2  CG7101-RA (CG7101), mRNA 
NM_206283.1  CG8398-RD, transcript variant D (CG8398), mRNA 
NM_139794.1  CG8398-RA, transcript variant A (CG8398), mRNA 
NM_168173.1  CG8398-RB, transcript variant B (CG8398), mRNA 
NM_168174.1  CG8398-RC, transcript variant C (CG8398), mRNA 
10  NM_206422.1  CG32447-RB, transcript variant B (CG32447), mRNA 
10  NM_168935.1  CG32447-RA, transcript variant A (CG32447), mRNA 
NM_078875.2  similar to Deadpan CG10446-RA (Side), mRNA 
NM_078504.2  Topoisomerase 3beta CG3458-RA (Top3beta), mRNA 
NM_079407.2  Glycine receptor CG7446-RA (Grd), mRNA 
NM_168667.1  CG32159-RB (CG32159), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.