National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18802R-3 
 Symbol alpha-Man-II  Full Name alpha Mannosidase II 
 CG No CG18802  Old CG No CG18802 
 Synonyms dGMII, GMII, DM-GII.1, GmII, MAN-2, alpha-Man-II, CG8139, CG18474, CG18802, Man 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal, female semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGGCGGTTCGCTTTGGTAAT 
 Primer Seq. 3'
aatctagaggtaccGCTTGGTGTCGTGCTGGTAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

18802R-3.IR full       1   ------------TTTGGTAATTTGCTCCGGCTGCCTGCTGGTTTTCCTCAGCCTGTACAT 60
                                       ||||||||||||||||||||||||||||||||||||||||||||||||
18802R-3.in silico     1   TCGGCGGTTCGCTTTGGTAATTTGCTCCGGCTGCCTGCTGGTTTTCCTCAGCCTGTACAT 60


18802R-3.IR full       61  AATCCTCAATTTTGCGGCGCCGGCAGCCACCCAGATAAAGCCCAACTATGAGAACATTGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-3.in silico     61  AATCCTCAATTTTGCGGCGCCGGCAGCCACCCAGATAAAGCCCAACTATGAGAACATTGA 120


18802R-3.IR full       121 GAACAAGCTGCATGAGCTGGAAAATGGTTTGCAGGAGCACGGGGAGGAGATGCGGAATCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-3.in silico     121 GAACAAGCTGCATGAGCTGGAAAATGGTTTGCAGGAGCACGGGGAGGAGATGCGGAATCT 180


18802R-3.IR full       181 CAGGGCGCGTCTGGCCAAAACATCCAATCGCGACGATCCAATAAGACCTCCACTTAAAGT 240
                           |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||
18802R-3.in silico     181 CAGGGCGCGTCTTGCCGAAACATCCAATCGCGACGATCCAATAAGACCTCCACTTAAAGT 240


18802R-3.IR full       241 GGCTCGTTCCCCGAGGCCAGGGCAATGCCAAGATGTGGTCCAAGACGTGCCCAATGTGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-3.in silico     241 GGCTCGTTCCCCGAGGCCAGGGCAATGCCAAGATGTGGTCCAAGACGTGCCCAATGTGGA 300


18802R-3.IR full       301 TGTACAGATGCTGGAGCTATACGATCGCATGTCCTTCAAGGACATAGATGGAGGCGTGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-3.in silico     301 TGTACAGATGCTGGAGCTATACGATCGCATGTCCTTCAAGGACATAGATGGAGGCGTGTG 360


18802R-3.IR full       361 GAAACAGGGCTGGAACATTAAGTACGATCCACTGAAGTACAACGCCCATCACAAACTAAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-3.in silico     361 GAAACAGGGCTGGAACATTAAGTACGATCCACTGAAGTACAACGCCCATCACAAACTAAA 420


18802R-3.IR full       421 AGTCTTGTTTGTGCCGCACTCGCACAACGATCCTGGATGGATTCAGACGTTTGAGGAATA 480
                           ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
18802R-3.in silico     421 AGTCTTCGTTGTGCCGCACTCGCACAACGATCCTGGATGGATTCAGACGTTTGAGGAATA 480


18802R-3.IR full       481 CTACCAGCACGACACCA--- 500
                           |||||||||||||||||   
18802R-3.in silico     481 CTACCAGCACGACACCAAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079567.2  alpha Mannosidase II CG18802-RA (alpha-Man-II), mRNA 
NM_166326.1  CG15118-RC, transcript variant C (CG15118), mRNA 
NM_166327.1  CG15118-RD, transcript variant D (CG15118), mRNA 
NM_137552.2  CG15118-RB, transcript variant B (CG15118), mRNA 
NM_166325.1  CG15118-RA, transcript variant A (CG15118), mRNA 
NM_141653.2  CG16789-RA (CG16789), mRNA 
NM_140229.2  CG7351-RA (CG7351), mRNA 
NM_141775.1  CG14695-RA (CG14695), mRNA 
NM_141394.2  CG10284-RA (CG10284), mRNA 
NM_166629.1  Upf3 CG11184-RB, transcript variant B (Upf3), mRNA 
NM_138000.2  Upf3 CG11184-RC, transcript variant C (Upf3), mRNA 
NM_206102.1  Cap-G CG17054-RE, transcript variant E (Cap-G), mRNA 
NM_206105.1  Cap-G CG17054-RB, transcript variant B (Cap-G), mRNA 
NM_136995.2  Cap-G CG17054-RA, transcript variant A (Cap-G), mRNA 
NM_206104.1  Cap-G CG17054-RC, transcript variant C (Cap-G), mRNA 
NM_206103.1  Cap-G CG17054-RD, transcript variant D (Cap-G), mRNA 
NM_079453.2  gigas CG6975-RA (gig), mRNA 
NM_136412.2  polypeptide GalNAc transferase 3 CG4445-RA (pgant3), mRNA 
11  NM_142237.2  alpha-Man-IIb CG4606-RA (alpha-Man-IIb), mRNA 
NM_133101.2  CG7101-RA (CG7101), mRNA 
NM_206283.1  CG8398-RD, transcript variant D (CG8398), mRNA 
NM_139794.1  CG8398-RA, transcript variant A (CG8398), mRNA 
NM_168173.1  CG8398-RB, transcript variant B (CG8398), mRNA 
NM_168174.1  CG8398-RC, transcript variant C (CG8398), mRNA 
10  NM_206422.1  CG32447-RB, transcript variant B (CG32447), mRNA 
10  NM_168935.1  CG32447-RA, transcript variant A (CG32447), mRNA 
NM_078875.2  similar to Deadpan CG10446-RA (Side), mRNA 
NM_078504.2  Topoisomerase 3beta CG3458-RA (Top3beta), mRNA 
NM_079407.2  Glycine receptor CG7446-RA (Grd), mRNA 
NM_168667.1  CG32159-RB (CG32159), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.