National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18780R-1 
 Symbol MED20  Full Name Mediator complex subunit 20 
 CG No CG18780  Old CG No CG18780 
 Synonyms Med20, Trfp, TrfP, Srb2/TRFP, dTrfp, p29, dTrap26, Tmr, l(2)28DE, CG18267, CG18780, MED20 
 Accession No (Link to NCBI) NM_079924.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTTCAACCGTATCCCTTACCC 
 Primer Seq. 3'
aatctagaggtaccTTCACAGCAATGCCGAGGAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTTCAACCGT ATCCCTTACC CGAAGGCAAA TCGGGTGCCC ACATAATCGA TNCAGCTGAG 
0061 CAAGCGTCNT GCTCGCCCTG GGCGCCACAC ATGCCGGTCA ATTTCTGGTG GACTGCGAAA 
0121 CGTTCATCTC GACGCCACAG CCGCACAATG GAGCACCTGG ACGCGCAGTC CACGTCCTGC 
0181 ACAACTCCGA GTATCCCGCC TCCACGTTCT CGATCATCGA CAATGGCACC GGCAAACAAG 
0241 TGGCCATTGT CGCCGACAAT ATCTTCGATC TGCTCATGCT CAAGATGACC AACACCTTCA 
0301 CCTCCAAAAA GCAGACCAAA ATCGAGTCCC GTGGCGCTCG TTTCGAGTAT GGTGACTTTG 
0361 TTATCAAACT CGGTTCCGTC ACCATGATGG AGCACTTCAA GGGCATCCTC ATCGAAATCG 
0421 AGTACAAGTC ATGCGTGATT CTGGCCTACT GCTGGGAAAT GATACGCGAA ATGCTGCAGG 
0481 GATTCCTCGG CATTGCTGTG AA 
 in silico PCR Fragment
0001 CTTCAACCGT ATCCCTTACC CGAAGGCAAA TCGGGTGCCC ACATAATCGA T-CAGCTGAG 
0061 CAAGCGTC-T GCTCGCCCTG GGCGCCACAC ATGCCGGTCA ATTTCTGGTG GACTGCGAAA 
0121 CGTTCATCTC GACGCCACAG CCGCACAATG GAGCACCTGG ACGCGCAGTC CACGTCCTGC 
0181 ACAACTCCGA GTATCCCGCC TCCACGTTCT CGATCATCGA CAATGGCACC GGCAAACAAG 
0241 TGGCCATTGT CGCCGACAAT ATCTTCGATC TGCTCATGCT CAAGATGACC AACACCTTCA 
0301 CCTCCAAAAA GCAGACCAAA ATCGAGTCCC GTGGCGCTCG TTTCGAGTAT GGTGACTTTG 
0361 TTATCAAACT CGGTTCCGTC ACCATGATGG AGCACTTCAA GGGCATCCTC ATCGAAATCG 
0421 AGTACAAGTC ATGCGTGATT CTGGCCTACT GCTGGGAAAT GATACGCGAA ATGCTGCAGG 
0481 GATTCCTCGG CATTGCTGTG AA 
 Assemble Data

18780R-1.IR_full       1   CTTCAACCGTATCCCTTACCCGAAGGCAAATCGGGTGCCCACATAATCGATNCAGCTGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
18780R-1.in silico     1   CTTCAACCGTATCCCTTACCCGAAGGCAAATCGGGTGCCCACATAATCGAT-CAGCTGAG 60


18780R-1.IR_full       61  CAAGCGTCNTGCTCGCCCTGGGCGCCACACATGCCGGTCAATTTCTGGTGGACTGCGAAA 120
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
18780R-1.in silico     61  CAAGCGTC-TGCTCGCCCTGGGCGCCACACATGCCGGTCAATTTCTGGTGGACTGCGAAA 120


18780R-1.IR_full       121 CGTTCATCTCGACGCCACAGCCGCACAATGGAGCACCTGGACGCGCAGTCCACGTCCTGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18780R-1.in silico     121 CGTTCATCTCGACGCCACAGCCGCACAATGGAGCACCTGGACGCGCAGTCCACGTCCTGC 180


18780R-1.IR_full       181 ACAACTCCGAGTATCCCGCCTCCACGTTCTCGATCATCGACAATGGCACCGGCAAACAAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18780R-1.in silico     181 ACAACTCCGAGTATCCCGCCTCCACGTTCTCGATCATCGACAATGGCACCGGCAAACAAG 240


18780R-1.IR_full       241 TGGCCATTGTCGCCGACAATATCTTCGATCTGCTCATGCTCAAGATGACCAACACCTTCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18780R-1.in silico     241 TGGCCATTGTCGCCGACAATATCTTCGATCTGCTCATGCTCAAGATGACCAACACCTTCA 300


18780R-1.IR_full       301 CCTCCAAAAAGCAGACCAAAATCGAGTCCCGTGGCGCTCGTTTCGAGTATGGTGACTTTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18780R-1.in silico     301 CCTCCAAAAAGCAGACCAAAATCGAGTCCCGTGGCGCTCGTTTCGAGTATGGTGACTTTG 360


18780R-1.IR_full       361 TTATCAAACTCGGTTCCGTCACCATGATGGAGCACTTCAAGGGCATCCTCATCGAAATCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18780R-1.in silico     361 TTATCAAACTCGGTTCCGTCACCATGATGGAGCACTTCAAGGGCATCCTCATCGAAATCG 420


18780R-1.IR_full       421 AGTACAAGTCATGCGTGATTCTGGCCTACTGCTGGGAAATGATACGCGAAATGCTGCAGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18780R-1.in silico     421 AGTACAAGTCATGCGTGATTCTGGCCTACTGCTGGGAAATGATACGCGAAATGCTGCAGG 480


18780R-1.IR_full       481 GATTCCTCGGCATTGCTGTGAA 502
                           ||||||||||||||||||||||
18780R-1.in silico     481 GATTCCTCGGCATTGCTGTGAA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079924.2  CG18780-RA (MED20), mRNA 
0   NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 
0   NM_001032106.1  CG7100-RL, transcript variant L (CadN), mRNA 
0   NM_139778.2  CG10274-RA (CG10274), mRNA 
0   NM_136058.3  CG10346-RA (Grip71), mRNA 
0   NM_138088.2  CG11414-RA (CG11414), mRNA 
0   NM_001014503.1  CG8715-RD, transcript variant D (lig), mRNA 
0   NM_165586.2  CG8715-RB, transcript variant B (lig), mRNA 
0   NM_136504.3  CG8715-RA, transcript variant A (lig), mRNA 
0   NM_206056.2  CG8715-RC, transcript variant C (lig), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_137991.1  CG4763-RA (CG4763), mRNA 
0   NM_079845.2  CG7951-RA (sima), mRNA 
0   NM_141644.2  CG9379-RA (by), mRNA 
0   NM_166903.1  CG12598-RB, transcript variant B (Adar), mRNA 
0   NM_130584.2  CG12598-RA, transcript variant A (Adar), mRNA 
0   NM_001038732.1  CG12598-RC, transcript variant C (Adar), mRNA 
0   NM_132844.2  CG8952-RA (CG8952), mRNA 
0   10  NM_132627.1  CG4346-RA (rad), mRNA 
0   NM_057949.3  CG10270-RA (D19B), mRNA 
0   NM_057954.2  CG5005-RA (HLH54F), mRNA 
0   NM_001014529.1  CG33505-RA (CG33505), mRNA 
0   NM_137582.2  CG11237-RA (Oseg6), mRNA 
0   NM_141408.3  CG1137-RA (CG1137), mRNA 
0   NM_166408.1  CG9025-RB, transcript variant B (CG9025), mRNA 
0   NM_137664.1  CG9025-RA, transcript variant A (CG9025), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
VM
+- 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
++ 
VM
++ 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.