National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18557R-2 
 Symbol CG18557  Full Name CG18557 
 CG No CG18557  Old CG No CG18557 
 Synonyms c-SPH125, CG18557 
 Accession No (Link to NCBI) NM_134877.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     1   GCGGCGAGTCATATTTATCAGATGCTGTTTCTGGACGCTAACTGAGACGGGAGCACCGTG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGGCCTCCAGATGGAGTGCGTGCCCCAGGGACTGTGCAAAACGAGCGCTTGGAATCAGAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGCTATTTCTTGGCCGAGCCCGTGCCAGAGATCAGAAAGTTGCTGTCACAGTTCTCAAAA 180

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     181 GTTAGTGATCGGTGCTCCGCTAAACTGTGGCAAGAGTAATCCCAATGGCCTGGGC-GGCA 240

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      241 AGTAGAAGAGGTTGTCGATCAGGCGAAACCCAATGAGTTCCCTTGGACTGTGGCTCTGA 299

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGCAAAACTTGATCAACTTCTTTGGCGCGGGAACTCTGGTCACCGAAAACATTGTGATAA 359

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCGCTGCCCACCTGATGCTAGACAAGACCATCAACGACTTCGGAATCATCGGCGGTGCAT 419

                           ||||||||||||||||||||||||||||| | | || ||||||||||||||||||||||| silico     421 GGGATTTGAAGCAGCTGGCTGGTAAAACG-ATTCAGTGGCGAACTGCGACCAGGATTGTA 479

18557R-2.IR_full       481 TCGCATCCGGACTTCAACAAAA 501
                           |||||||||||||||||||||| silico     481 TCGCATCCGGACTTCAACAAAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134877.1  CG18557-RA (CG18557), mRNA 
0   NM_079395.2  CG9695-RA (Dab), mRNA 
0   NM_137748.2  CG10080-RA (CG10080), mRNA 
0   NM_057883.2  CG10117-RA (ttv), mRNA 
0   NM_168249.1  CG7892-RF, transcript variant F (nmo), mRNA 
0   NM_168252.1  CG7892-RB, transcript variant B (nmo), mRNA 
0   NM_168251.1  CG7892-RA, transcript variant A (nmo), mRNA 
0   NM_168248.1  CG7892-RE, transcript variant E (nmo), mRNA 
0   NM_168253.2  CG7892-RD, transcript variant D (nmo), mRNA 
0   NM_168250.1  CG7892-RG, transcript variant G (nmo), mRNA 
0   NM_079243.2  CG7892-RC, transcript variant C (nmo), mRNA 
0   NM_170092.2  CG10374-RA, transcript variant A (Lsd-1), mRNA 
0   NM_142926.3  CG10374-RC, transcript variant C (Lsd-1), mRNA 
0   NM_170093.2  CG10374-RB, transcript variant B (Lsd-1), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_141415.1  CG15177-RA (CG15177), mRNA 
0   NM_167088.1  CG3203-RB, transcript variant B (RpL17), mRNA 
0   NM_167089.1  CG3203-RC, transcript variant C (RpL17), mRNA 
0   NM_167087.1  CG3203-RA, transcript variant A (RpL17), mRNA 
0   NM_132118.2  CG3203-RD, transcript variant D (RpL17), mRNA 
0   NM_132898.2  CG4394-RC, transcript variant C (Traf3), mRNA 
0   NM_167518.1  CG4394-RB, transcript variant B (Traf3), mRNA 
0   NM_167517.1  CG4394-RA, transcript variant A (Traf3), mRNA 
0   NM_001042957.1  CG18140-RA (Cht3), mRNA 
0   NM_080296.2  CG16785-RA (fz3), mRNA 
0   NM_170372.1  CG9983-RC, transcript variant C (Hrb98DE), mRNA 
0   NM_170374.1  CG9983-RF, transcript variant F (Hrb98DE), mRNA 
0   NM_079819.2  CG9983-RB, transcript variant B (Hrb98DE), mRNA 
0   NM_170373.1  CG9983-RD, transcript variant D (Hrb98DE), mRNA 
0   NM_136417.2  CG1859-RA (Spn43Ad), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.