National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18557R-1 
 Symbol CG18557  Full Name CG18557 
 CG No CG18557  Old CG No CG18557 
 Synonyms c-SPH125, CG18557 
 Accession No (Link to NCBI) NM_134877.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGGCGAGTCATATTTATCAG 
 Primer Seq. 3'
aatctagaggtaccTTTTGTTGAAGTCCGGATGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGGCGAGTC ATATTTATCA GATGCTGTTT CTGGACGCTA ACTGGGACGG GAGCACCGTG 
0061 TGGCCTCCAG ATGGAGTGCG TGCCCCAGGG ACTGTGCAAA ACGAGCGCTT GGAATCAGAA 
0121 TGCTATTTCT TGGCCGAGCC CGTGCCAGAG ATCAGAAAGT TGCTGTCACA GTTCTCAAAA 
0181 GTTAGTGATC GGTGCTCCGC TAAACTGTGG CAAGAGTAAT CCCAATGGCC TGGGCTGGCA 
0241 NAGTAGAAGA GGTTGTCGAT CAGGCGAAAC CCAATGAGTT CCCTTGGACT GTGGCTCTGA 
0301 TGCAAAACTT GATCAACTTC TTTGGCGCGG GAACTCTGGT CACCGAAAAC ATTGTGATAA 
0361 CCGCTGCCCA CCTGATGCTA GACAAGACCA TCAACGACTT CGGAATCATC GGCGGTGCAT 
0421 GGGATTTGAA GCAGCTGGCT GGTAAAACGN ANTNAGNGGC GAACTGCGAC CAGGATTGTA 
0481 TCGCATCCGG ACTTCAACAA AA 
 in silico PCR Fragment
0001 GCGGCGAGTC ATATTTATCA GATGCTGTTT CTGGACGCTA ACTGAGACGG GAGCACCGTG 
0061 TGGCCTCCAG ATGGAGTGCG TGCCCCAGGG ACTGTGCAAA ACGAGCGCTT GGAATCAGAA 
0121 TGCTATTTCT TGGCCGAGCC CGTGCCAGAG ATCAGAAAGT TGCTGTCACA GTTCTCAAAA 
0181 GTTAGTGATC GGTGCTCCGC TAAACTGTGG CAAGAGTAAT CCCAATGGCC TGGGC-GGCA 
0241 CAGTAGAAGA GGTTGTCGAT CAGGCGAAAC CCAATGAGTT CCCTTGGACT GTGGCTCTGA 
0301 TGCAAAACTT GATCAACTTC TTTGGCGCGG GAACTCTGGT CACCGAAAAC ATTGTGATAA 
0361 CCGCTGCCCA CCTGATGCTA GACAAGACCA TCAACGACTT CGGAATCATC GGCGGTGCAT 
0421 GGGATTTGAA GCAGCTGGCT GGTAAAACG- ATTCAGTGGC GAACTGCGAC CAGGATTGTA 
0481 TCGCATCCGG ACTTCAACAA AA 
 Assemble Data

18557R-1.IR_full       1   GCGGCGAGTCATATTTATCAGATGCTGTTTCTGGACGCTAACTGGGACGGGAGCACCGTG 60
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
18557R-1.in silico     1   GCGGCGAGTCATATTTATCAGATGCTGTTTCTGGACGCTAACTGAGACGGGAGCACCGTG 60


18557R-1.IR_full       61  TGGCCTCCAGATGGAGTGCGTGCCCCAGGGACTGTGCAAAACGAGCGCTTGGAATCAGAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18557R-1.in silico     61  TGGCCTCCAGATGGAGTGCGTGCCCCAGGGACTGTGCAAAACGAGCGCTTGGAATCAGAA 120


18557R-1.IR_full       121 TGCTATTTCTTGGCCGAGCCCGTGCCAGAGATCAGAAAGTTGCTGTCACAGTTCTCAAAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18557R-1.in silico     121 TGCTATTTCTTGGCCGAGCCCGTGCCAGAGATCAGAAAGTTGCTGTCACAGTTCTCAAAA 180


18557R-1.IR_full       181 GTTAGTGATCGGTGCTCCGCTAAACTGTGGCAAGAGTAATCCCAATGGCCTGGGCTGGCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
18557R-1.in silico     181 GTTAGTGATCGGTGCTCCGCTAAACTGTGGCAAGAGTAATCCCAATGGCCTGGGC-GGCA 240


18557R-1.IR_full        241 AGTAGAAGAGGTTGTCGATCAGGCGAAACCCAATGAGTTCCCTTGGACTGTGGCTCTGA 299
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18557R-1.in silico      241 AGTAGAAGAGGTTGTCGATCAGGCGAAACCCAATGAGTTCCCTTGGACTGTGGCTCTGA 299


18557R-1.IR_full       301 TGCAAAACTTGATCAACTTCTTTGGCGCGGGAACTCTGGTCACCGAAAACATTGTGATAA 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18557R-1.in silico     301 TGCAAAACTTGATCAACTTCTTTGGCGCGGGAACTCTGGTCACCGAAAACATTGTGATAA 359


18557R-1.IR_full       361 CCGCTGCCCACCTGATGCTAGACAAGACCATCAACGACTTCGGAATCATCGGCGGTGCAT 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18557R-1.in silico     361 CCGCTGCCCACCTGATGCTAGACAAGACCATCAACGACTTCGGAATCATCGGCGGTGCAT 419


18557R-1.IR_full       421 GGGATTTGAAGCAGCTGGCTGGTAAAACGNANTNAGNGGCGAACTGCGACCAGGATTGTA 479
                           ||||||||||||||||||||||||||||| | | || |||||||||||||||||||||||
18557R-1.in silico     421 GGGATTTGAAGCAGCTGGCTGGTAAAACG-ATTCAGTGGCGAACTGCGACCAGGATTGTA 479


18557R-1.IR_full       481 TCGCATCCGGACTTCAACAAAA 501
                           ||||||||||||||||||||||
18557R-1.in silico     481 TCGCATCCGGACTTCAACAAAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134877.1  CG18557-RA (CG18557), mRNA 
0   NM_079395.2  CG9695-RA (Dab), mRNA 
0   NM_137748.2  CG10080-RA (CG10080), mRNA 
0   NM_057883.2  CG10117-RA (ttv), mRNA 
0   NM_168249.1  CG7892-RF, transcript variant F (nmo), mRNA 
0   NM_168252.1  CG7892-RB, transcript variant B (nmo), mRNA 
0   NM_168251.1  CG7892-RA, transcript variant A (nmo), mRNA 
0   NM_168248.1  CG7892-RE, transcript variant E (nmo), mRNA 
0   NM_168253.2  CG7892-RD, transcript variant D (nmo), mRNA 
0   NM_168250.1  CG7892-RG, transcript variant G (nmo), mRNA 
0   NM_079243.2  CG7892-RC, transcript variant C (nmo), mRNA 
0   NM_170092.2  CG10374-RA, transcript variant A (Lsd-1), mRNA 
0   NM_142926.3  CG10374-RC, transcript variant C (Lsd-1), mRNA 
0   NM_170093.2  CG10374-RB, transcript variant B (Lsd-1), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_141415.1  CG15177-RA (CG15177), mRNA 
0   NM_167088.1  CG3203-RB, transcript variant B (RpL17), mRNA 
0   NM_167089.1  CG3203-RC, transcript variant C (RpL17), mRNA 
0   NM_167087.1  CG3203-RA, transcript variant A (RpL17), mRNA 
0   NM_132118.2  CG3203-RD, transcript variant D (RpL17), mRNA 
0   NM_132898.2  CG4394-RC, transcript variant C (Traf3), mRNA 
0   NM_167518.1  CG4394-RB, transcript variant B (Traf3), mRNA 
0   NM_167517.1  CG4394-RA, transcript variant A (Traf3), mRNA 
0   NM_001042957.1  CG18140-RA (Cht3), mRNA 
0   NM_080296.2  CG16785-RA (fz3), mRNA 
0   NM_170372.1  CG9983-RC, transcript variant C (Hrb98DE), mRNA 
0   NM_170374.1  CG9983-RF, transcript variant F (Hrb98DE), mRNA 
0   NM_079819.2  CG9983-RB, transcript variant B (Hrb98DE), mRNA 
0   NM_170373.1  CG9983-RD, transcript variant D (Hrb98DE), mRNA 
0   NM_136417.2  CG1859-RA (Spn43Ad), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.