National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18497R-4 
 Symbol spen  Full Name split ends 
 CG No CG18497  Old CG No CG18497 
 Synonyms Splitends, CG18497, rno, EK2-9, E(Sev-CycE)2A, EY2-7, spe, E(E2F)2A, l(2)k08102, l(2)k07612, l(2)k06805, l(2)03350, poc, 136/24, yip1, En(yan[ACT])2-7, E(Raf)2A, BcDNA:GM01870, spen 
 Accession No (Link to NCBI) NM_164374.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Oswald F, Rodriguez P, Giaimo BD, Antonello ZA, Mira L, Mittler G, Thiel VN, Collins KJ, Tabaja N, Cizelsky W, Rothe M, Kühl SJ, Kühl M, Ferrante F, Hein K, Kovall RA, Dominguez M, Borggrefe T.
A phospho-dependent mechanism involving NCoR and KMT2D controls a permissive chromatin state at Notch target genes.
Nucleic Acids Res. (2016) [ PubMed ID = 26912830 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CAGCAACAACAGTTCGTTGTGGATAGCAGCACCATTATAAATAACAACAACAATAACAAC 60

                           ||||||||||||||||||||||||||||||||| ||||| |||||||||||| ||||||| silico     61  AATAATAATAATAATCAAAAATTGAAAAGGTCTACAGAGGAACCACCGACAAACAGCTTC 120

                           ||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     121 GAACGGAATTATTACGACCGCACCACCAGCCGTTTAGTCACGCAGTATCAAGCGAACAAC 180

                           ||| ||||||||||| ||||| ||||||||||||||| |||| ||||||||||||||||| silico     181 TCAACTTCCTTGGCCAATTCAAACTCCAGTCCCTCGT-CCGT-GAGCGCCTCCGCGTCAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCTTCGCTACGGCGGCAGGAGGGTCTTCCGAGAGATCACGCAACCGAGATCGCCCGTACA 300

                           ||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| silico     301 GGAATGGTTCTGCCAGCGTTCAAGGCGGCGGCATCA--ACAGCAGCAACACGACGACGAC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACAGCAGCCTGCACAGCTGGAGGATCTGGATCGGGAGCAATTGGAACTGGGACTGGGGG 420

                           |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     421 TTTGGTAGGCTCAGGTCCTGGGGGAGTACCGCAGGCGCTAGGCGACCGCAGCAGCACCCA 480

18497R-4.IR_full       481 GAATATCCACCAGAACCATCAGAG 504
                           |||||||||||||||||||||||| silico     481 GAATATCCACCAGAACCATCAGAG 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  28  87  NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
100   482  28  87  NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
82.15   396  15  NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
3.11   15  22  74  171  NM_079002.2  CG3905-RA (Su(z)2), mRNA 
1.24   31  54  NM_165915.1  CG8815-RB, transcript variant B (Sin3A), mRNA 
1.24   31  54  NM_165916.1  CG8815-RC, transcript variant C (Sin3A), mRNA 
1.24   31  54  NM_136955.2  CG8815-RA, transcript variant A (Sin3A), mRNA 
1.03   11  63  96  NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
1.03   10  17  66  NM_057792.2  CG9019-RA (dsf), mRNA 
1.03   28  74  NM_078662.2  CG5488-RA (B-H2), mRNA 
1.03   21  100  NM_142397.1  CG14318-RA (CG14318), mRNA 
1.03   28  NM_079859.2  CG1438-RA (Cyp4c3), mRNA 
0.82   44  120  NM_079224.3  CG10037-RA (vvl), mRNA 
0.82   27  NM_168646.1  CG32156-RC, transcript variant C (Mbs), mRNA 
0.82   27  NM_168648.1  CG32156-RB, transcript variant B (Mbs), mRNA 
0.82   27  NM_168647.1  CG32156-RA, transcript variant A (Mbs), mRNA 
0.82   50  NM_137169.3  CG11798-RA, transcript variant A (chn), mRNA 
0.82   50  NM_206119.1  CG11798-RB, transcript variant B (chn), mRNA 
0.82   50  NM_001043082.1  CG11798-RC, transcript variant C (chn), mRNA 
0.62   23  64  104  NM_166999.2  CG32790-RA (CG32790), mRNA 
0.62   17  47  89  NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0.62   17  47  89  NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0.62   11  41  88  NM_134299.3  CG3151-RF, transcript variant F (Rbp9), mRNA 
0.62   11  41  88  NM_134300.3  CG3151-RC, transcript variant C (Rbp9), mRNA 
0.62   11  39  81  NM_057589.2  CG3151-RA, transcript variant A (Rbp9), mRNA 
0.62   11  39  81  NM_057588.2  CG3151-RD, transcript variant D (Rbp9), mRNA 
0.62   11  39  80  NM_001014462.1  CG3151-RG, transcript variant G (Rbp9), mRNA 
0.62   11  39  80  NM_134298.3  CG3151-RE, transcript variant E (Rbp9), mRNA 
0.62   11  39  80  NM_134297.3  CG3151-RB, transcript variant B (Rbp9), mRNA 
0.62   59  150  NM_135259.2  CG4502-RA, transcript variant A (CG4502), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.