National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18497R-1 
 Symbol spen  Full Name split ends 
 CG No CG18497  Old CG No CG18497 
 Synonyms Splitends, CG18497, rno, EK2-9, E(Sev-CycE)2A, EY2-7, spe, E(E2F)2A, l(2)k08102, l(2)k07612, l(2)k06805, l(2)03350, poc, 136/24, yip1, En(yan[ACT])2-7, E(Raf)2A, BcDNA:GM01870, spen 
 Accession No (Link to NCBI) NM_164374.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Oswald F, Rodriguez P, Giaimo BD, Antonello ZA, Mira L, Mittler G, Thiel VN, Collins KJ, Tabaja N, Cizelsky W, Rothe M, Kühl SJ, Kühl M, Ferrante F, Hein K, Kovall RA, Dominguez M, Borggrefe T.
A phospho-dependent mechanism involving NCoR and KMT2D controls a permissive chromatin state at Notch target genes.
Nucleic Acids Res. (2016) 44(10) 4703-20 [ PubMed ID = 26912830 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGCAACAACAGTTCGTTGTG 
 Primer Seq. 3'
aatctagaggtaccCTCTGATGGTTCTGGTGGATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGCAACAAC AGTTCGTTGT GGATAGCAGC ACCATTATAA ATAACAACAA CAATAACAAC 
0061 AATAATAATA ATAATCAAAA ATTGAAAAGG TCTNCAGAGT AACCACCGAC AANCAGCTTC 
0121 GAACGNAATT ATTACGACCG CACCACCAGC CGTTTAGTCA NGCAGTATCA AGCGAACAAN 
0181 TCANCTTCCT TGGCCHATTC ANACTCCAGT CCCTCGTNCC GTNGAGcgcC TCCGCGTCAG 
0241 TCTTCgCTAC GGCGGCAGGA GGGTCTTCCG AGAGATCACG CAACCGAGAT CGCCCGTACA 
0301 GGAATGGTTC TGCCAGCGTT CAAGGCGGCG GCATCATTAC AGCAGCAACA CGACGACGAC 
0361 GACAGCAGCC TGCACAGCTG GAGGATCTGG ATCGGGAGCA ATTGGAACTG GGACTGGGGG 
0421 TTTGGTAGGC TCAGGTCCTG GGGGAGTANC GCAGGCGCTA gGCGACCGCA GCAGCACCCA 
0481 GAATATCCAC CAGAACCATC AGAG 
 in silico PCR Fragment
0001 CAGCAACAAC AGTTCGTTGT GGATAGCAGC ACCATTATAA ATAACAACAA CAATAACAAC 
0061 AATAATAATA ATAATCAAAA ATTGAAAAGG TCTACAGAGG AACCACCGAC AAACAGCTTC 
0121 GAACGGAATT ATTACGACCG CACCACCAGC CGTTTAGTCA CGCAGTATCA AGCGAACAAC 
0181 TCAACTTCCT TGGCCAATTC AAACTCCAGT CCCTCGT-CC GT-GAGCGCC TCCGCGTCAG 
0241 TCTTCGCTAC GGCGGCAGGA GGGTCTTCCG AGAGATCACG CAACCGAGAT CGCCCGTACA 
0301 GGAATGGTTC TGCCAGCGTT CAAGGCGGCG GCATCA--AC AGCAGCAACA CGACGACGAC 
0361 GACAGCAGCC TGCACAGCTG GAGGATCTGG ATCGGGAGCA ATTGGAACTG GGACTGGGGG 
0421 TTTGGTAGGC TCAGGTCCTG GGGGAGTACC GCAGGCGCTA GGCGACCGCA GCAGCACCCA 
0481 GAATATCCAC CAGAACCATC AGAG 
 Assemble Data

18497R-1.IR_full       1   CAGCAACAACAGTTCGTTGTGGATAGCAGCACCATTATAAATAACAACAACAATAACAAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18497R-1.in silico     1   CAGCAACAACAGTTCGTTGTGGATAGCAGCACCATTATAAATAACAACAACAATAACAAC 60


18497R-1.IR_full       61  AATAATAATAATAATCAAAAATTGAAAAGGTCTNCAGAGTAACCACCGACAANCAGCTTC 120
                           ||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||
18497R-1.in silico     61  AATAATAATAATAATCAAAAATTGAAAAGGTCTACAGAGGAACCACCGACAAACAGCTTC 120


18497R-1.IR_full       121 GAACGNAATTATTACGACCGCACCACCAGCCGTTTAGTCANGCAGTATCAAGCGAACAAN 180
                           ||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| 
18497R-1.in silico     121 GAACGGAATTATTACGACCGCACCACCAGCCGTTTAGTCACGCAGTATCAAGCGAACAAC 180


18497R-1.IR_full       181 TCANCTTCCTTGGCCHATTCANACTCCAGTCCCTCGTNCCGTNGAGCGCCTCCGCGTCAG 240
                           ||| ||||||||||| ||||| ||||||||||||||| |||| |||||||||||||||||
18497R-1.in silico     181 TCAACTTCCTTGGCCAATTCAAACTCCAGTCCCTCGT-CCGT-GAGCGCCTCCGCGTCAG 240


18497R-1.IR_full       241 TCTTCGCTACGGCGGCAGGAGGGTCTTCCGAGAGATCACGCAACCGAGATCGCCCGTACA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18497R-1.in silico     241 TCTTCGCTACGGCGGCAGGAGGGTCTTCCGAGAGATCACGCAACCGAGATCGCCCGTACA 300


18497R-1.IR_full       301 GGAATGGTTCTGCCAGCGTTCAAGGCGGCGGCATCATTACAGCAGCAACACGACGACGAC 360
                           ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
18497R-1.in silico     301 GGAATGGTTCTGCCAGCGTTCAAGGCGGCGGCATCA--ACAGCAGCAACACGACGACGAC 360


18497R-1.IR_full       361 GACAGCAGCCTGCACAGCTGGAGGATCTGGATCGGGAGCAATTGGAACTGGGACTGGGGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18497R-1.in silico     361 GACAGCAGCCTGCACAGCTGGAGGATCTGGATCGGGAGCAATTGGAACTGGGACTGGGGG 420


18497R-1.IR_full       421 TTTGGTAGGCTCAGGTCCTGGGGGAGTANCGCAGGCGCTAGGCGACCGCAGCAGCACCCA 480
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
18497R-1.in silico     421 TTTGGTAGGCTCAGGTCCTGGGGGAGTACCGCAGGCGCTAGGCGACCGCAGCAGCACCCA 480


18497R-1.IR_full       481 GAATATCCACCAGAACCATCAGAG 504
                           ||||||||||||||||||||||||
18497R-1.in silico     481 GAATATCCACCAGAACCATCAGAG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  28  87  NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
100   482  28  87  NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
82.15   396  15  NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
3.11   15  22  74  171  NM_079002.2  CG3905-RA (Su(z)2), mRNA 
1.24   31  54  NM_165915.1  CG8815-RB, transcript variant B (Sin3A), mRNA 
1.24   31  54  NM_165916.1  CG8815-RC, transcript variant C (Sin3A), mRNA 
1.24   31  54  NM_136955.2  CG8815-RA, transcript variant A (Sin3A), mRNA 
1.03   11  63  96  NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
1.03   10  17  66  NM_057792.2  CG9019-RA (dsf), mRNA 
1.03   28  74  NM_078662.2  CG5488-RA (B-H2), mRNA 
1.03   21  100  NM_142397.1  CG14318-RA (CG14318), mRNA 
1.03   28  NM_079859.2  CG1438-RA (Cyp4c3), mRNA 
0.82   44  120  NM_079224.3  CG10037-RA (vvl), mRNA 
0.82   27  NM_168646.1  CG32156-RC, transcript variant C (Mbs), mRNA 
0.82   27  NM_168648.1  CG32156-RB, transcript variant B (Mbs), mRNA 
0.82   27  NM_168647.1  CG32156-RA, transcript variant A (Mbs), mRNA 
0.82   50  NM_137169.3  CG11798-RA, transcript variant A (chn), mRNA 
0.82   50  NM_206119.1  CG11798-RB, transcript variant B (chn), mRNA 
0.82   50  NM_001043082.1  CG11798-RC, transcript variant C (chn), mRNA 
0.62   23  64  104  NM_166999.2  CG32790-RA (CG32790), mRNA 
0.62   17  47  89  NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0.62   17  47  89  NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0.62   11  41  88  NM_134299.3  CG3151-RF, transcript variant F (Rbp9), mRNA 
0.62   11  41  88  NM_134300.3  CG3151-RC, transcript variant C (Rbp9), mRNA 
0.62   11  39  81  NM_057589.2  CG3151-RA, transcript variant A (Rbp9), mRNA 
0.62   11  39  81  NM_057588.2  CG3151-RD, transcript variant D (Rbp9), mRNA 
0.62   11  39  80  NM_001014462.1  CG3151-RG, transcript variant G (Rbp9), mRNA 
0.62   11  39  80  NM_134298.3  CG3151-RE, transcript variant E (Rbp9), mRNA 
0.62   11  39  80  NM_134297.3  CG3151-RB, transcript variant B (Rbp9), mRNA 
0.62   59  150  NM_135259.2  CG4502-RA, transcript variant A (CG4502), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.