National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18478R-1 
 Symbol CG18478  Full Name CG18478 
 CG No CG18478  Old CG No CG18478 
 Synonyms SPH157, DS07108.5, BG:DS07108.5, CG18478 
 Accession No (Link to NCBI) NM_135920.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCCAGATGCTGTGAAAGTGC 
 Primer Seq. 3'
aatctagaggtaccATCCTGACAGATATGCCTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTCCAGATGC TGTGAAAGTG CAATTTAATG TTACCGAAGG GCAAGCAAAA CCAGCCGAGT 
0061 TTCCGTGGAC CATTGCCGTG ATCCACAATC GCAGCTTAGT GGGTGGTGGC TCTTTAATTA 
0121 CCCCAGACAT TGTGCTCACA GCTGCCCATC GGATATTCAA TAAAGACGTG GAGGATATAG 
0181 TCGTCAGCGC AGGAGAATGG GAGTACGGAT CTGCTTTGGA AAAATATCCA TTTGAAGAGG 
0241 CATTTGTGTT GAAAATGGTT ATACATAAAT CATTTAATTA TCAGAGAGGC GCCAACAACT 
0301 TAGCGCTGCT CTTCCTGGAT AGGGAGTTCC CACTAACATA CAAGATTAAC ACCATCTGTT 
0361 TGCCCACCCA GAAAAGATCG CTATCTTCCA CTCGCTGTAT AGTGGCTGGT TGGGGTAAAT 
0421 ATCAGTTTAG TGACACGCAT TATGGAGGCG TCCTGAAGAA AATTGATTTA CCTATTGTAC 
0481 CCAGGCATAT CTGTCAGGAT  
 in silico PCR Fragment
0001 ATCCAGATGC TGTGAAAGTG CAATTTAATG TTACCGAAGG GCAAGCAAAA CCAGCCGAGT 
0061 TTCCGTGGAC CATTGCCGTG ATCCACAATC GCAGCTTAGT GGGTGGTGGC TCTTTAATTA 
0121 CCCCAGACAT TGTGCTCACA GCTGCCCATC GGATATTCAA TAAAGACGTG GAGGATATAG 
0181 TCGTCAGCGC AGGAGAATGG GAGTACGGAT CTGCTTTGGA AAAATATCCA TTTGAAGAGG 
0241 CATTTGTGTT GAAAATGGTT ATACATAAAT CATTTAATTA TCAGAGAGGC GCCAACAACT 
0301 TAGCGCTGCT CTTCCTGGAT AGGGAGTTCC CACTAACATA CAAGATTAAC ACCATTTGTT 
0361 TGCCCACCCA GAAAAGATCG CTATCTTCCA CTCGCTGTAT AGTGGCTGGT TGGGGTAAAT 
0421 ATCAGTTTAG TGACACGCAT TACGGAGGCG TCCTGAAGAA AATTGATTTA CCTATTGTAC 
0481 CCAGGCATAT CTGTCAGGAT  
 Assemble Data

18478R-1.IR_full        1   TCCAGATGCTGTGAAAGTGCAATTTAATGTTACCGAAGGGCAAGCAAAACCAGCCGAGT 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18478R-1.in silico      1   TCCAGATGCTGTGAAAGTGCAATTTAATGTTACCGAAGGGCAAGCAAAACCAGCCGAGT 59


18478R-1.IR_full       61  TTCCGTGGACCATTGCCGTGATCCACAATCGCAGCTTAGTGGGTGGTGGCTCTTTAATTA 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18478R-1.in silico     61  TTCCGTGGACCATTGCCGTGATCCACAATCGCAGCTTAGTGGGTGGTGGCTCTTTAATTA 119


18478R-1.IR_full       121 CCCCAGACATTGTGCTCACAGCTGCCCATCGGATATTCAATAAAGACGTGGAGGATATAG 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18478R-1.in silico     121 CCCCAGACATTGTGCTCACAGCTGCCCATCGGATATTCAATAAAGACGTGGAGGATATAG 179


18478R-1.IR_full       181 TCGTCAGCGCAGGAGAATGGGAGTACGGATCTGCTTTGGAAAAATATCCATTTGAAGAGG 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18478R-1.in silico     181 TCGTCAGCGCAGGAGAATGGGAGTACGGATCTGCTTTGGAAAAATATCCATTTGAAGAGG 239


18478R-1.IR_full       241 CATTTGTGTTGAAAATGGTTATACATAAATCATTTAATTATCAGAGAGGCGCCAACAACT 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18478R-1.in silico     241 CATTTGTGTTGAAAATGGTTATACATAAATCATTTAATTATCAGAGAGGCGCCAACAACT 299


18478R-1.IR_full       301 TAGCGCTGCTCTTCCTGGATAGGGAGTTCCCACTAACATACAAGATTAACACCATCTGTT 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
18478R-1.in silico     301 TAGCGCTGCTCTTCCTGGATAGGGAGTTCCCACTAACATACAAGATTAACACCATTTGTT 359


18478R-1.IR_full       361 TGCCCACCCAGAAAAGATCGCTATCTTCCACTCGCTGTATAGTGGCTGGTTGGGGTAAAT 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18478R-1.in silico     361 TGCCCACCCAGAAAAGATCGCTATCTTCCACTCGCTGTATAGTGGCTGGTTGGGGTAAAT 419


18478R-1.IR_full       421 ATCAGTTTAGTGACACGCATTATGGAGGCGTCCTGAAGAAAATTGATTTACCTATTGTAC 479
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
18478R-1.in silico     421 ATCAGTTTAGTGACACGCATTACGGAGGCGTCCTGAAGAAAATTGATTTACCTATTGTAC 479


18478R-1.IR_full       481 CCAGGCATATCTGTCAGGAT 499
                           ||||||||||||||||||||
18478R-1.in silico     481 CCAGGCATATCTGTCAGGAT 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165122.1  CG31827-RA (CG31827), mRNA 
100   482  NM_135920.1  CG18478-RA (CG18478), mRNA 
0   NM_165208.1  CG31750-RA (Gr36d), mRNA 
0   NM_206198.1  CG9294-RB, transcript variant B (CG9294), mRNA 
0   NM_137772.1  CG9294-RA, transcript variant A (CG9294), mRNA 
0   NM_057276.3  CG4178-RA (Lsp1beta), mRNA 
0   NM_078794.2  CG9564-RA (Try29F), mRNA 
0   NM_141998.1  CG11670-RA (CG11670), mRNA 
0   NM_142634.2  CG4241-RA, transcript variant A (att-ORFA), mRNA 
0   NM_205945.1  CG3811-RD, transcript variant D (Oatp30B), mRNA 
0   NM_135449.2  CG3811-RB, transcript variant B (Oatp30B), mRNA 
0   NM_205946.1  CG3811-RC, transcript variant C (Oatp30B), mRNA 
0   NM_164857.1  CG3811-RA, transcript variant A (Oatp30B), mRNA 
0   NM_143379.2  CG1647-RA (CG1647), mRNA 
0   NM_078699.2  CG1692-RA (mal), mRNA 
0   NM_001038864.1  CG4927-RC (CG4927), mRNA 
0   NM_176342.1  CG11661-RH, transcript variant H (Nc73EF), mRNA 
0   NM_168704.2  CG11661-RE, transcript variant E (Nc73EF), mRNA 
0   NM_168701.2  CG11661-RA, transcript variant A (Nc73EF), mRNA 
0   NM_168702.1  CG11661-RB, transcript variant B (Nc73EF), mRNA 
0   NM_176341.1  CG11661-RG, transcript variant G (Nc73EF), mRNA 
0   NM_176340.1  CG11661-RF, transcript variant F (Nc73EF), mRNA 
0   NM_168703.2  CG11661-RC, transcript variant C (Nc73EF), mRNA 
0   NM_141242.1  CG1126-RA (CG1126), mRNA 
0   NM_079603.2  CG5657-RA (Scgbeta), mRNA 
0   11  NM_168346.1  CG32043-RB, transcript variant B (CG32043), mRNA 
0   11  NM_140064.2  CG32043-RA, transcript variant A (CG32043), mRNA 
0   NM_132932.2  CG9634-RA (CG9634), mRNA 
0   NM_130539.2  CG11382-RB (CG11382), mRNA 
0   NM_139400.1  CG8001-RA (CG8001), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.