National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18455R-2 
 Symbol Optix  Full Name Optix 
 CG No CG18455  Old CG No CG18455 
 Synonyms optix, opt, CG18455, D-Six3, Dsix3, Six3, anon-WO0153538.79, Optix 
 Accession No (Link to NCBI) NM_079956.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Martín M, Ostalé CM, de Celis JF.
Patterning of the Drosophila L2 vein is driven by regulatory interactions between region-specific transcription factors expressed in response to Dpp signalling.
Development (2017) 144(17) 3168-3176 [ PubMed ID = 28760811 ] [ RRC reference ]

Okamoto N, Nishimori Y, Nishimura T.
Conserved role for the Dachshund protein with Drosophila Pax6 homolog Eyeless in insulin expression.
Proc. Natl. Acad. Sci. U.S.A. (2012) 109(7) 2406-11 [ PubMed ID = 22308399 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTTGGACCGACGGAGGGCAAACAGCCGCCCTCAGAGAGCTTCTCGCCCACGCACCACCAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATTATAGCACCCAGCCCCATCCTGGCCGTTCCAACGCTGGCCTTCTCCGCCGCCCAGGTG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAGATCGTTTGCAAGACGCTCGAGGACTCCGGCGACATCGAGCGGTTGGCCCGCTTCCTC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGGAGCCTGCCGGTGGCCCTGCCCAACATGCACGAGATCCTCAACTGCGAGGCGGTGCTC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGTGCCCGCGCAGTGGTCGCCTACCATGTGGGCAACTTCAGGGAACTTTATGCAATAATA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAGAATCATAAGTTTACTAAGGCGTCCTACGGCAAACTGCAGGCCATGTGGCTGGAGGCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CACTACATTGAGGCCGAGAAGCTGCGCGGTCGATCACTGGGCCCCGTGGACAAGTATCGG 420

                           ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     421 GTGCGAAAGAAGTTCCCCCTGCCGCCGACGATCTGGGATGGCGAGCAGAAG-ACGCACTG 480

18455R-2.IR_full       481 CTTCAAGGATGCGCACCGN 499
                           ||||||||| ||||| || silico     481 CTTCAAGGA-GCGCA-CGC 499

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   478  NM_079956.2  CG18455-RA, transcript variant A (Optix), mRNA 
0.2   22  45  NM_168872.1  CG3871-RB, transcript variant B (Six4), mRNA 
0.2   22  45  NM_140999.2  CG3871-RA, transcript variant A (Six4), mRNA 
0   14  NM_168487.1  CG32096-RB, transcript variant B (rols), mRNA 
0   NM_078551.2  CG2227-RA (Gip), mRNA 
0   NM_143428.2  CG14514-RA (Brd8), mRNA 
0   NM_057483.3  CG10181-RA (Mdr65), mRNA 
0   NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_142070.2  CG3050-RA, transcript variant A (Cyp6d5), mRNA 
0   NM_169567.1  CG3050-RB, transcript variant B (Cyp6d5), mRNA 
0   NM_139515.3  CG1291-RA (CG1291), mRNA 
0   NM_078710.2  CG1666-RA (Hlc), mRNA 
0   NM_206788.1  CG33254-RA (CG33254), mRNA 
0   NM_176553.1  CG6129-RC, transcript variant C (CG6129), mRNA 
0   18  NM_057385.4  CG11121-RA (so), mRNA 
0   NM_080033.2  CG1624-RC, transcript variant C (dpld), mRNA 
0   NM_165533.1  CG1624-RA, transcript variant A (dpld), mRNA 
0   NM_165534.1  CG1624-RB, transcript variant B (dpld), mRNA 
0   NM_136574.2  CG8258-RA (CG8258), mRNA 
0   NM_140776.2  CG13699-RA (CG13699), mRNA 
0   NM_143524.2  CG9743-RA (CG9743), mRNA 
0   NM_143357.1  CG17856-RA (CG17856), mRNA 
0   NM_168263.1  CG17352-RA, transcript variant A (CG17352), mRNA 
0   NM_001038906.1  CG17352-RD, transcript variant D (CG17352), mRNA 
0   NM_139957.2  CG17352-RC, transcript variant C (CG17352), mRNA 
0   NM_168264.1  CG17352-RB, transcript variant B (CG17352), mRNA 
0   NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_142842.1  CG7023-RB, transcript variant B (CG7023), mRNA 
0   NM_170041.1  CG7023-RA, transcript variant A (CG7023), mRNA 
0   NM_136151.1  CG10366-RA (CG10366), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.