National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1838R-3 
 Symbol myoglianin  Full Name myoglianin 
 CG No CG1838  Old CG No CG1838 
 Synonyms Myoglianin, CG1838, BcDNA:LD02307, myoglianin 
 Accession No (Link to NCBI) NM_166786.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Hevia CF, de Celis JF.
Activation and function of TGFβ signalling during Drosophila wing development and its interactions with the BMP pathway.
Dev. Biol. (2013) 377(1) 138-53 [ PubMed ID = 23485686 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   TGAACTCCAACGAAATCCAGTTTCCAGGTTCTTACAGATTTAATCTTGACTCAAAAAAA 59

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATAAATATCGGGCGAATGAATATTCTTGGACATAAGAGAGGTAATTTCCGTGTAACTCGA 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TATGTCACGGTCACCGTACTCTTAATTTTATCGACTGCAGTCAATGCTTATGCTCAGCCA 179

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAAAATAAAAGCTTCAGTAATTCTTCCAACAACGATAGTCCGGAAATGGTTATGTTGAGT 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AACGAAACAAACAATAGTGCAAAAGTACTATCAGAAAAAAATGGTTCTTCTTCAATATCG 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCGGATGATAAAATAAATGAAAATATGGGAATATTCCAAATGAAAGTACAAAGTAAACCG 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGGAAAAAAAGTACCCCTTTAGCAAAGGTATCAGAGCATGGAGATTTATCAAGAGTTCAA 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGTGTATCTTTGTATCGCAATACCTTAATAAATATAGAAAGTATGCTACAGCGTCAGTTG 479

1838R-3.IR_full       481 CGTGAGAAAGCCAAAGTGGA 499
                          |||||||||||||||||||| silico     481 CGTGAGAAAGCCAAAGTGGA 499

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166787.1  CG1838-RC, transcript variant C (myoglianin), mRNA 
100   482  NM_079888.4  CG1838-RB, transcript variant B (myoglianin), mRNA 
100   482  NM_166788.1  CG1838-RD, transcript variant D (myoglianin), mRNA 
100   482  NM_166786.1  CG1838-RA, transcript variant A (myoglianin), mRNA 
0   NM_142287.1  CG14882-RA (CG14882), mRNA 
0   NM_168118.1  CG32422-RA (CG32422), mRNA 
0   NM_170111.1  CG5410-RD, transcript variant D (Miro), mRNA 
0   NM_142948.2  CG5410-RE, transcript variant E (Miro), mRNA 
0   NM_166245.1  CG4966-RB, transcript variant B (CG4966), mRNA 
0   NM_142866.1  CG6733-RA (CG6733), mRNA 
0   NM_137402.2  CG4966-RA, transcript variant A (CG4966), mRNA 
0   NM_169581.1  CG31320-RA (CG31320), mRNA 
0   NM_165871.1  CG8850-RB, transcript variant B (CG8850), mRNA 
0   NM_136911.2  CG8850-RA, transcript variant A (CG8850), mRNA 
0   NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   NM_165919.1  CG17759-RA, transcript variant A (Galpha49B), mRNA 
0   NM_165923.1  CG17759-RG, transcript variant G (Galpha49B), mRNA 
0   NM_165921.1  CG17759-RC, transcript variant C (Galpha49B), mRNA 
0   NM_165922.1  CG17759-RE, transcript variant E (Galpha49B), mRNA 
0   NM_078994.2  CG17759-RH, transcript variant H (Galpha49B), mRNA 
0   NM_165920.1  CG17759-RB, transcript variant B (Galpha49B), mRNA 
0   NM_166745.1  CG31999-RA (CG31999), mRNA 
0   NM_135083.2  CG6634-RA (mid), mRNA 
0   11  NM_206731.1  CG9045-RE, transcript variant E (Myb), mRNA 
0   NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_168232.2  CG32369-RA, transcript variant A (CG32369), mRNA 
0   NM_139899.3  CG32369-RB, transcript variant B (CG32369), mRNA 
0   NM_001014563.1  CG7524-RF, transcript variant F (Src64B), mRNA 
0   NM_001014562.1  CG7524-RC, transcript variant C (Src64B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.