National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1838R-1 
 Symbol myoglianin  Full Name myoglianin 
 CG No CG1838  Old CG No CG1838 
 Synonyms Myoglianin, CG1838, BcDNA:LD02307, myoglianin 
 Accession No (Link to NCBI) NM_166786.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hevia CF, de Celis JF.
Activation and function of TGFβ signalling during Drosophila wing development and its interactions with the BMP pathway.
Dev Biol (2013) 377(1) 138-53 [ PubMed ID = 23485686 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGAACTCCAACGAAATCCAG 
 Primer Seq. 3'
aatctagaggtaccTCCACTTTGGCTTTCTCACGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGAACTCCA ACGAAATCCA GTTTCCAGGT TCTTACAGAT TTAATCTTGA CTCAAAAAAA 
0061 ATAAATATCG GGCGAATGAA TATTCTTGGA CATAAGAGAG GTAATTTCCG TGTAACTCGA 
0121 TATGTCACGG TCACCGTACT CTTAATTTTA TCGACTGCAG TCAATGCTTA TGCTCAGCCA 
0181 GAAAATAAAA GCTTCAGTAA TTCTTCCAAC AACGATAGTC CGGAAATGGT TATGTTGAGT 
0241 AACGAAACAA ACAATAGTGC AAAAGTACTA TCAGAAAAAA ATGGTTCTTC TTCAATATCG 
0301 GCGGATGATA AAATAAATGA AAATATGGGA ATATTCCAAA TGAAAGTACA AAGTAAACCG 
0361 GGGAAAAAAA GTACCCCTTT AGCAAAGGTA TCAGAGCATG GAGATTTATC AAGAGTTCAA 
0421 AGTGTATCTT TGTATCGCAA TACCTTAATA AATATAGAAA GTATGCTACA GCGTCAGTTG 
0481 CGTGAGAAAG CCAAAGTGGA  
 in silico PCR Fragment
0001 GTGAACTCCA ACGAAATCCA GTTTCCAGGT TCTTACAGAT TTAATCTTGA CTCAAAAAAA 
0061 ATAAATATCG GGCGAATGAA TATTCTTGGA CATAAGAGAG GTAATTTCCG TGTAACTCGA 
0121 TATGTCACGG TCACCGTACT CTTAATTTTA TCGACTGCAG TCAATGCTTA TGCTCAGCCA 
0181 GAAAATAAAA GCTTCAGTAA TTCTTCCAAC AACGATAGTC CGGAAATGGT TATGTTGAGT 
0241 AACGAAACAA ACAATAGTGC AAAAGTACTA TCAGAAAAAA ATGGTTCTTC TTCAATATCG 
0301 GCGGATGATA AAATAAATGA AAATATGGGA ATATTCCAAA TGAAAGTACA AAGTAAACCG 
0361 GGGAAAAAAA GTACCCCTTT AGCAAAGGTA TCAGAGCATG GAGATTTATC AAGAGTTCAA 
0421 AGTGTATCTT TGTATCGCAA TACCTTAATA AATATAGAAA GTATGCTACA GCGTCAGTTG 
0481 CGTGAGAAAG CCAAAGTGGA  
 Assemble Data

1838R-1.IR_full        1   TGAACTCCAACGAAATCCAGTTTCCAGGTTCTTACAGATTTAATCTTGACTCAAAAAAA 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1838R-1.in silico      1   TGAACTCCAACGAAATCCAGTTTCCAGGTTCTTACAGATTTAATCTTGACTCAAAAAAA 59


1838R-1.IR_full       61  ATAAATATCGGGCGAATGAATATTCTTGGACATAAGAGAGGTAATTTCCGTGTAACTCGA 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1838R-1.in silico     61  ATAAATATCGGGCGAATGAATATTCTTGGACATAAGAGAGGTAATTTCCGTGTAACTCGA 119


1838R-1.IR_full       121 TATGTCACGGTCACCGTACTCTTAATTTTATCGACTGCAGTCAATGCTTATGCTCAGCCA 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1838R-1.in silico     121 TATGTCACGGTCACCGTACTCTTAATTTTATCGACTGCAGTCAATGCTTATGCTCAGCCA 179


1838R-1.IR_full       181 GAAAATAAAAGCTTCAGTAATTCTTCCAACAACGATAGTCCGGAAATGGTTATGTTGAGT 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1838R-1.in silico     181 GAAAATAAAAGCTTCAGTAATTCTTCCAACAACGATAGTCCGGAAATGGTTATGTTGAGT 239


1838R-1.IR_full       241 AACGAAACAAACAATAGTGCAAAAGTACTATCAGAAAAAAATGGTTCTTCTTCAATATCG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1838R-1.in silico     241 AACGAAACAAACAATAGTGCAAAAGTACTATCAGAAAAAAATGGTTCTTCTTCAATATCG 299


1838R-1.IR_full       301 GCGGATGATAAAATAAATGAAAATATGGGAATATTCCAAATGAAAGTACAAAGTAAACCG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1838R-1.in silico     301 GCGGATGATAAAATAAATGAAAATATGGGAATATTCCAAATGAAAGTACAAAGTAAACCG 359


1838R-1.IR_full       361 GGGAAAAAAAGTACCCCTTTAGCAAAGGTATCAGAGCATGGAGATTTATCAAGAGTTCAA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1838R-1.in silico     361 GGGAAAAAAAGTACCCCTTTAGCAAAGGTATCAGAGCATGGAGATTTATCAAGAGTTCAA 419


1838R-1.IR_full       421 AGTGTATCTTTGTATCGCAATACCTTAATAAATATAGAAAGTATGCTACAGCGTCAGTTG 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1838R-1.in silico     421 AGTGTATCTTTGTATCGCAATACCTTAATAAATATAGAAAGTATGCTACAGCGTCAGTTG 479


1838R-1.IR_full       481 CGTGAGAAAGCCAAAGTGGA 499
                          ||||||||||||||||||||
1838R-1.in silico     481 CGTGAGAAAGCCAAAGTGGA 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166787.1  CG1838-RC, transcript variant C (myoglianin), mRNA 
100   482  NM_079888.4  CG1838-RB, transcript variant B (myoglianin), mRNA 
100   482  NM_166788.1  CG1838-RD, transcript variant D (myoglianin), mRNA 
100   482  NM_166786.1  CG1838-RA, transcript variant A (myoglianin), mRNA 
0   NM_142287.1  CG14882-RA (CG14882), mRNA 
0   NM_168118.1  CG32422-RA (CG32422), mRNA 
0   NM_170111.1  CG5410-RD, transcript variant D (Miro), mRNA 
0   NM_142948.2  CG5410-RE, transcript variant E (Miro), mRNA 
0   NM_166245.1  CG4966-RB, transcript variant B (CG4966), mRNA 
0   NM_142866.1  CG6733-RA (CG6733), mRNA 
0   NM_137402.2  CG4966-RA, transcript variant A (CG4966), mRNA 
0   NM_169581.1  CG31320-RA (CG31320), mRNA 
0   NM_165871.1  CG8850-RB, transcript variant B (CG8850), mRNA 
0   NM_136911.2  CG8850-RA, transcript variant A (CG8850), mRNA 
0   NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   NM_165919.1  CG17759-RA, transcript variant A (Galpha49B), mRNA 
0   NM_165923.1  CG17759-RG, transcript variant G (Galpha49B), mRNA 
0   NM_165921.1  CG17759-RC, transcript variant C (Galpha49B), mRNA 
0   NM_165922.1  CG17759-RE, transcript variant E (Galpha49B), mRNA 
0   NM_078994.2  CG17759-RH, transcript variant H (Galpha49B), mRNA 
0   NM_165920.1  CG17759-RB, transcript variant B (Galpha49B), mRNA 
0   NM_166745.1  CG31999-RA (CG31999), mRNA 
0   NM_135083.2  CG6634-RA (mid), mRNA 
0   11  NM_206731.1  CG9045-RE, transcript variant E (Myb), mRNA 
0   NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_168232.2  CG32369-RA, transcript variant A (CG32369), mRNA 
0   NM_139899.3  CG32369-RB, transcript variant B (CG32369), mRNA 
0   NM_001014563.1  CG7524-RF, transcript variant F (Src64B), mRNA 
0   NM_001014562.1  CG7524-RC, transcript variant C (Src64B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.