National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18350R-3 
 Symbol Sxl  Full Name Sex lethal 
 CG No CG18350  Old CG No CG18350 
 Synonyms dSXL, SXL, sxl, Sx1, DmSxl, Sxl-1 Sxl-2, fs(1)M106, CG33070, l(1)6Fa, fs(1)K1274, Su(da), Mex156, Fl, CG18350, Sxl, SxlPe, SxL 
 Accession No (Link to NCBI) NM_167116.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees female lethal 
 Map Viewer
 Reference
[Please submit your publication]
Suissa Y, Kalifa Y, Dinur T, Graham P, Deshpande G, Schedl P, Gerlitz O.
Hrp48 attenuates Sxl expression to allow for proper notch expression and signaling in wing development.
Proc. Natl. Acad. Sci. U.S.A. (2010) 107(15) 6930-5 [ PubMed ID = 20351283 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCAACAATAATCCGGGTAGT 
 Primer Seq. 3'
aatctagaggtaccATTTCCGATGTGAAGTCCACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCAACAATA ATCCGGGTAG TAACAATAAT AATGGTGGTT ATCCCCCATA TGGCTACAAC 
0061 AACAAGTCGA GTGGTGGGCG TGGATTTGGG ATGTCCCATT CTCTGCCATC CGGAATGGAT 
0121 ACAGAATTTT CATTTCCAAG TTCATCGTCG CGTCGTGGTT ACAATGATTT CCCCGGCTGC 
0181 GGCGGCAGCG GCGGAAATGG TGGGAGTGCC AACAATTTAG GGGGCGGCAA CATGTGCCAC 
0241 CTGCCGCCGA TGGCCAGCAA CAACTCGCTG AATAATCTCT GCGGATTGTC GCTGGGCAGC 
0301 GGTGGTAGTG ATGATCTCAT GAACGATCCT CGGGCAAGCA ACACCAACCT GATTGTCAAC 
0361 TACTTGCCCC AGGACATGAC CGATCGCGAG CTGTACGCCC TATTCAGAGC CATTGGACCC 
0421 ATCAACACGT GCAGAATCAT GCGAGACTAT AAGACTGGCT ACAGTTTTGG TTATGCTTTC 
0481 GTGGACTTCA CATCGGAAAT  
 in silico PCR Fragment
0001 GGCAACAATA ATCCGGGTAG TAACAATAAT AATGGTGGTT ATCCCCCATA TGGCTACAAC 
0061 AACAAGTCGA GTGGTGGGCG TGGATTTGGG ATGTCCCATT CTCTGCCATC CGGAATGGAT 
0121 ACAGAATTTT CATTTCCAAG TTCATCGTCG CGTCGTGGTT ACAATGATTT CCCCGGCTGC 
0181 GGCGGCAGCG GCGGAAATGG TGGGAGTGCC AACAATTTAG GGGGCGGCAA CATGTGCCAC 
0241 CTGCCGCCGA TGGCCAGCAA CAACTCGCTG AATAATCTCT GCGGATTGTC GCTGGGCAGC 
0301 GGTGGTAGTG ATGATCTCAT GAACGATCCT CGGGCAAGCA ACACCAACCT GATTGTCAAC 
0361 TACTTGCCCC AGGACATGAC CGATCGCGAG CTGTACGCCC TATTCAGAGC CATTGGACCC 
0421 ATCAACACGT GCAGAATCAT GCGAGACTAT AAGACTGGCT ACAGTTTTGG TTATGCTTTC 
0481 GTGGACTTCA CATCGGAAAT  
 Assemble Data

18350R-3.IR_full       1   GGCAACAATAATCCGGGTAGTAACAATAATAATGGTGGTTATCCCCCATATGGCTACAAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18350R-3.in silico     1   GGCAACAATAATCCGGGTAGTAACAATAATAATGGTGGTTATCCCCCATATGGCTACAAC 60


18350R-3.IR_full       61  AACAAGTCGAGTGGTGGGCGTGGATTTGGGATGTCCCATTCTCTGCCATCCGGAATGGAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18350R-3.in silico     61  AACAAGTCGAGTGGTGGGCGTGGATTTGGGATGTCCCATTCTCTGCCATCCGGAATGGAT 120


18350R-3.IR_full       121 ACAGAATTTTCATTTCCAAGTTCATCGTCGCGTCGTGGTTACAATGATTTCCCCGGCTGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18350R-3.in silico     121 ACAGAATTTTCATTTCCAAGTTCATCGTCGCGTCGTGGTTACAATGATTTCCCCGGCTGC 180


18350R-3.IR_full       181 GGCGGCAGCGGCGGAAATGGTGGGAGTGCCAACAATTTAGGGGGCGGCAACATGTGCCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18350R-3.in silico     181 GGCGGCAGCGGCGGAAATGGTGGGAGTGCCAACAATTTAGGGGGCGGCAACATGTGCCAC 240


18350R-3.IR_full       241 CTGCCGCCGATGGCCAGCAACAACTCGCTGAATAATCTCTGCGGATTGTCGCTGGGCAGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18350R-3.in silico     241 CTGCCGCCGATGGCCAGCAACAACTCGCTGAATAATCTCTGCGGATTGTCGCTGGGCAGC 300


18350R-3.IR_full       301 GGTGGTAGTGATGATCTCATGAACGATCCTCGGGCAAGCAACACCAACCTGATTGTCAAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18350R-3.in silico     301 GGTGGTAGTGATGATCTCATGAACGATCCTCGGGCAAGCAACACCAACCTGATTGTCAAC 360


18350R-3.IR_full       361 TACTTGCCCCAGGACATGACCGATCGCGAGCTGTACGCCCTATTCAGAGCCATTGGACCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18350R-3.in silico     361 TACTTGCCCCAGGACATGACCGATCGCGAGCTGTACGCCCTATTCAGAGCCATTGGACCC 420


18350R-3.IR_full       421 ATCAACACGTGCAGAATCATGCGAGACTATAAGACTGGCTACAGTTTTGGTTATGCTTTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18350R-3.in silico     421 ATCAACACGTGCAGAATCATGCGAGACTATAAGACTGGCTACAGTTTTGGTTATGCTTTC 480


18350R-3.IR_full       481 GTGGACTTCACATCGGAAAT 500
                           ||||||||||||||||||||
18350R-3.in silico     481 GTGGACTTCACATCGGAAAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167114.2  CG18350-RH, transcript variant H (Sxl), mRNA 
100   482  NM_167116.2  CG18350-RG, transcript variant G (Sxl), mRNA 
100   482  NM_167110.2  CG18350-RJ, transcript variant J (Sxl), mRNA 
100   482  NM_001031890.1  CG14425-RA, transcript variant A (CG14425), mRNA 
96.47   465  NM_167112.2  CG18350-RD, transcript variant D (Sxl), mRNA 
96.47   465  NM_001031894.1  CG18350-RL, transcript variant L (Sxl), mRNA 
96.26   464  NM_001031893.1  CG18350-RM, transcript variant M (Sxl), mRNA 
96.26   464  NM_167117.2  CG18350-RF, transcript variant F (Sxl), mRNA 
96.26   464  NM_167118.2  CG18350-RB, transcript variant B (Sxl), mRNA 
92.73   447  NM_001031895.1  CG18350-RK, transcript variant K (Sxl), mRNA 
86.09   415  NM_080052.3  CG18350-RC, transcript variant C (Sxl), mRNA 
86.09   415  NM_001031892.1  CG18350-RN, transcript variant N (Sxl), mRNA 
86.09   415  NM_001031891.1  CG18350-RO, transcript variant O (Sxl), mRNA 
85.26   411  NM_167113.2  CG18350-RE, transcript variant E (Sxl), mRNA 
85.26   411  NM_167115.2  CG18350-RA, transcript variant A (Sxl), mRNA 
82.15   396  NM_167111.2  CG18350-RI, transcript variant I (Sxl), mRNA 
0.2   NM_130578.2  CG32809-RD, transcript variant D (CG32809), mRNA 
0   17  11  NM_130552.2  CG3056-RA, transcript variant A (CG3056), mRNA 
0   17  11  NM_206603.1  CG3056-RB, transcript variant B (CG3056), mRNA 
0   NM_080294.3  CG3056-RB, transcript variant B (CG3056), mRNA, abnormal vision CG4262-RA, transcript variant A (elav), mRNA 
0   NM_001014713.1  CG3056-RB, transcript variant B (CG3056), mRNA, abnormal vision CG4262-RA, transcript variant A (elav), mRNA, abnormal vision CG4262-RB, transcript variant B (elav), mRNA 
0   16  29  NM_143745.2  CG18389-RA (Eip93F), mRNA 
0   NM_169458.1  CG11502-RA, transcript variant A (svp), mRNA 
0   27  NM_141458.2  CG32466-RA, transcript variant A (rn), mRNA 
0   18  NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   18  NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   18  NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   18  NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   30  NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_001014679.1  CG33553-RC, transcript variant C (Doa), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.