National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18290R-3 
 Symbol Act87E  Full Name Actin 87E 
 CG No CG18290  Old CG No CG18290 
 Synonyms CG18290, Actin, actin, E, mus87E, act 87E, act87E, Act87E 
 Accession No (Link to NCBI) NM_057743.3 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTTGCCGCATTGGTCGTGGA 
 Primer Seq. 3'
aatctagaggtaccGGGCGTAACCCTCGTAGATGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGNTGCCGCA TTGGTCGTGG ACAATGGTTC CGGAATGTGC AAAGCAGGAT TCGCCGGCGA 
0061 TGATGACGCC TCGCGCCGTC TTCCCCTCGA TTGTGGGTCG TCCCCGTCAT CAGGGCGTAA 
0121 TGGTGGGCAT GGGACAGAAG GACTCCTATG TTGGTGATGA GGCCCAGAGC AAGCGTGGTA 
0181 TCCTCACCCT GAAATACCCC ATCGAGCACG GCATCATCAC CAACTGGGAC GATATGGAGA 
0241 AGATCTGGCA CCACACTTTC TATAACGAGC TGCGCGTNCG CCCCCGAGGA ACACCCCGTC 
0301 CTGCTGACCG AGGCCCCCCT GAACCCCAAG GCCAATCGCG AGAAGATGAC CCAGATCATG 
0361 TTCGAGACCT TCAACGCACC CGCCATGTAT GTGGCCATCC AGGCTGTGCT CTCGCTGTAC 
0421 GCCTCCGGTC GTACCACCGG TATTGTCCTC GACTCCGGTG AcGGTGTCTC CCACACCGTG 
0481 CCCATCTACG AGGGTTACGC CC 
 in silico PCR Fragment
0001 GGTTGCCGCA TTGGTCGTGG ACAATGGTTC CGGAATGTGC AAGGCAGGAT TCGCCGGCGA 
0061 TGATG-CGCC CCGCGCCGTC TTCCCCTCGA TTGTGGGTCG TCCCCGTCAT CAGGGCGTAA 
0121 TGGTGGGCAT GGGACAGAAG GACTCCTATG TTGGTGATGA GGCCCAGAGC AAGCGTGGTA 
0181 TCCTCACCCT GAAATACCCC ATCGAGCACG GCATCATCAC CAACTGGGAC GATATGGAGA 
0241 AGATCTGGCA CCACACTTTC TATAACGAGC TGCGCGT-CG CCCCCGAGGA ACACCCCGTC 
0301 CTGCTGACCG AGGCCCCCCT GAACCCCAAG GCCAATCGCG AGAAGATGAC CCAGATCATG 
0361 TTCGAGACCT TCAACGCACC CGCCATGTAT GTGGCCATCC AGGCTGTGCT CTCGCTGTAC 
0421 GCCTCCGGTC GTACCACCGG TATTGTCCTC GACTCCGGTG ACGGTGTCTC CCACACCGTG 
0481 CCCATCTACG AGGGTTACGC CC 
 Assemble Data

18290R-3.IR_full       1   GGNTGCCGCATTGGTCGTGGACAATGGTTCCGGAATGTGCAAAGCAGGATTCGCCGGCGA 60
                           || ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
18290R-3.in silico     1   GGTTGCCGCATTGGTCGTGGACAATGGTTCCGGAATGTGCAAGGCAGGATTCGCCGGCGA 60


18290R-3.IR_full       61  TGATGACGCCTCGCGCCGTCTTCCCCTCGATTGTGGGTCGTCCCCGTCATCAGGGCGTAA 120
                           ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||
18290R-3.in silico     61  TGATG-CGCCCCGCGCCGTCTTCCCCTCGATTGTGGGTCGTCCCCGTCATCAGGGCGTAA 120


18290R-3.IR_full       121 TGGTGGGCATGGGACAGAAGGACTCCTATGTTGGTGATGAGGCCCAGAGCAAGCGTGGTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18290R-3.in silico     121 TGGTGGGCATGGGACAGAAGGACTCCTATGTTGGTGATGAGGCCCAGAGCAAGCGTGGTA 180


18290R-3.IR_full       181 TCCTCACCCTGAAATACCCCATCGAGCACGGCATCATCACCAACTGGGACGATATGGAGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18290R-3.in silico     181 TCCTCACCCTGAAATACCCCATCGAGCACGGCATCATCACCAACTGGGACGATATGGAGA 240


18290R-3.IR_full       241 AGATCTGGCACCACACTTTCTATAACGAGCTGCGCGTNCGCCCCCGAGGAACACCCCGTC 300
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
18290R-3.in silico     241 AGATCTGGCACCACACTTTCTATAACGAGCTGCGCGT-CGCCCCCGAGGAACACCCCGTC 300


18290R-3.IR_full       301 CTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAATCGCGAGAAGATGACCCAGATCATG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18290R-3.in silico     301 CTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAATCGCGAGAAGATGACCCAGATCATG 360


18290R-3.IR_full       361 TTCGAGACCTTCAACGCACCCGCCATGTATGTGGCCATCCAGGCTGTGCTCTCGCTGTAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18290R-3.in silico     361 TTCGAGACCTTCAACGCACCCGCCATGTATGTGGCCATCCAGGCTGTGCTCTCGCTGTAC 420


18290R-3.IR_full       421 GCCTCCGGTCGTACCACCGGTATTGTCCTCGACTCCGGTGACGGTGTCTCCCACACCGTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18290R-3.in silico     421 GCCTCCGGTCGTACCACCGGTATTGTCCTCGACTCCGGTGACGGTGTCTCCCACACCGTG 480


18290R-3.IR_full       481 CCCATCTACGAGGGTTACGCCC 502
                           ||||||||||||||||||||||
18290R-3.in silico     481 CCCATCTACGAGGGTTACGCCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057743.3  CG18290-RA, transcript variant A (Act87E), mRNA 
100   482  NM_169525.1  CG18290-RB, transcript variant B (Act87E), mRNA 
23.85   115  112  98  93  NM_078497.2  CG4027-RB, transcript variant B (Act5C), mRNA 
23.85   115  112  98  93  NM_167053.1  CG4027-RA, transcript variant A (Act5C), mRNA 
23.85   115  112  98  93  NM_001014725.1  CG4027-RD, transcript variant D (Act5C), mRNA 
23.85   115  112  98  93  NM_001014726.1  CG4027-RC, transcript variant C (Act5C), mRNA 
14.31   69  93  107  100  NM_079643.1  CG5178-RA (Act88F), mRNA 
11.61   56  126  143  107  NM_079076.3  CG10067-RA, transcript variant A (Act57B), mRNA 
11.61   56  126  134  106  NM_166414.1  CG10067-RB, transcript variant B (Act57B), mRNA 
7.05   34  103  190  92  NM_079486.3  CG7478-RA (Act79B), mRNA 
0   60  122  126  NM_078901.2  CG12051-RA (Act42A), mRNA 
0   11  13  39  NM_079607.2  CG6174-RA (Arp87C), mRNA 
0   NM_132678.2  CG2691-RA (CG2691), mRNA 
0   NM_165847.1  CG8996-RA, transcript variant A (wal), mRNA 
0   NM_057627.3  CG8996-RB, transcript variant B (wal), mRNA 
0   16  51  NM_057689.1  CG5409-RA (Arp53D), mRNA 
0   NM_001015160.1  CG12449-PC.3 (CG12449), mRNA 
0   NM_001015161.1  CG12449-PE.3 (CG12449), mRNA 
0   NM_001015157.1  CG12449-PA.3 (CG12449), mRNA 
0   NM_001015158.1  CG12449-PD.3 (CG12449), mRNA 
0   NM_001015162.1  CG12449-PF.3 (CG12449), mRNA 
0   NM_001015159.1  CG12449-PB.3 (CG12449), mRNA 
0   NM_140737.1  CG6298-RA (Jon74E), mRNA 
0   NM_143059.1  CG13646-RA (CG13646), mRNA 
0   NM_079677.2  CG6027-RA (cdi), mRNA 
0   NM_057280.3  CG8695-RA (LvpL), mRNA 
0   NM_164443.1  CG31665-RA, transcript variant A (CG31665), mRNA 
0   NM_205889.1  CG31665-RB, transcript variant B (CG31665), mRNA 
0   NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.