National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18255R-1 
 Symbol Strn-Mlck  Full Name Stretchin-Mlck 
 CG No CG18255  Old CG No CG18255 
 Synonyms 143736_at, A(225), CT41348, MLCK, mlck, CG18255, unnamed, Mlc-k, CG8304, MLCK-2, MLCK-3, MLCK-1, Mlck, BEST:GH22543, BcDNA:RH74685, Strn-Mlck 
 Accession No (Link to NCBI) NM_166125.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Jang YG, Choi Y, Jun K, Chung J.
Mislocalization of TORC1 to Lysosomes Caused by KIF11 Inhibition Leads to Aberrant TORC1 Activity.
Mol Cells (2020) 43(8) 705-717 [ PubMed ID = 32759469 ] [ RRC reference ]

Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCCAGTGCAATGAGCACAAG 
 Primer Seq. 3'
aatctagaggtaccAAGTTCTCCGCCATTAGCATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCCAGTGCA ATGAGCACAA GCAACTCAAC GGCACACTCT CCTCGGCCTC GTCGGTCTAC 
0061 AGGAAAAGGA GCCGAGGTGA GATTCCCATT GAAAATTCCG ATCGCTTCCG CATCACGGCC 
0121 ACCAGCAATG CCGTCCAGCT GGCCGTGGAG CATGTGCAGC GGGAAGACGC CGGCCACTAC 
0181 ACGCTGTTCG CCCGGACGAA GAGGCAGGAT GTGGTGCGCA GGCACGTCGA GCTCATCGTG 
0241 GAGGACAGAT CCACAGGCGA CGATCCGCCG GTGTTCGTGC GCCGCCTGCC CGACCTATCC 
0301 GTCAAAGTGG GCACCCGGAC ACGCCTCCTA ACCGAAATAC GCAGCTCAAC AGATCTTAAG 
0361 CTAACCTGGG TACAGAAATG ATCGGAGAGT GTGCGCAAAC GACCGGATCA CGGAAGTCAA 
0421 TGAAGGCACC TTCCACTACT TGGAGATTAG TCCCGTGACG CCTGGACGAC GGTGGTCAGT 
0481 GGATGCTAAT GGCGGAGAAC TT 
 in silico PCR Fragment
0001 TGCCAGTGCA ATGAGCACAA GCAACTCAAC GGCACACTCT CCTCGGCCTC GTCGGTCTAC 
0061 AGGAAAAGGA GCCGAGGTGA GATTCCCATT GAAAATTCCG ATCGCTTCCG CATCACGGCC 
0121 ACCAGCAATG CCGTCCAGCT GGCCGTGGAG CATGTGCAGC GGGAAGACGC CGGCCACTAC 
0181 ACGCTGTTCG CCCGGACGAA GAGGCAGGAT GTGGTGCGCA GGCACGTCGA GCTCATCGTG 
0241 GAGGACAGAT CCACGGGCGA CGATCCGCCG GTGTTCGTGC GCCGCCTGCC CGACCTATCC 
0301 GTCAAAGTGG GCACCCGGAC ACGCCTCCTA ACCGAAATAC GCAGCTCAAC AGATCTTAAG 
0361 CTAACCT-GG TACAGAAATG ATCGGAGAGT GTGCGCAAAC GACCGGATCA CGGAAGTCAA 
0421 TGAAGGCACC TTCCACTACT TGGAGATTAG TCCCGTGACG -CTGGACGAC GGTGGTCAGT 
0481 GGATGCTAAT GGCGGAGAAC TT 
 Assemble Data

18255R-1.IR_full       1   TGCCAGTGCAATGAGCACAAGCAACTCAACGGCACACTCTCCTCGGCCTCGTCGGTCTAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18255R-1.in silico     1   TGCCAGTGCAATGAGCACAAGCAACTCAACGGCACACTCTCCTCGGCCTCGTCGGTCTAC 60


18255R-1.IR_full       61  AGGAAAAGGAGCCGAGGTGAGATTCCCATTGAAAATTCCGATCGCTTCCGCATCACGGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18255R-1.in silico     61  AGGAAAAGGAGCCGAGGTGAGATTCCCATTGAAAATTCCGATCGCTTCCGCATCACGGCC 120


18255R-1.IR_full       121 ACCAGCAATGCCGTCCAGCTGGCCGTGGAGCATGTGCAGCGGGAAGACGCCGGCCACTAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18255R-1.in silico     121 ACCAGCAATGCCGTCCAGCTGGCCGTGGAGCATGTGCAGCGGGAAGACGCCGGCCACTAC 180


18255R-1.IR_full       181 ACGCTGTTCGCCCGGACGAAGAGGCAGGATGTGGTGCGCAGGCACGTCGAGCTCATCGTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18255R-1.in silico     181 ACGCTGTTCGCCCGGACGAAGAGGCAGGATGTGGTGCGCAGGCACGTCGAGCTCATCGTG 240


18255R-1.IR_full       241 GAGGACAGATCCACAGGCGACGATCCGCCGGTGTTCGTGCGCCGCCTGCCCGACCTATCC 300
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
18255R-1.in silico     241 GAGGACAGATCCACGGGCGACGATCCGCCGGTGTTCGTGCGCCGCCTGCCCGACCTATCC 300


18255R-1.IR_full       301 GTCAAAGTGGGCACCCGGACACGCCTCCTAACCGAAATACGCAGCTCAACAGATCTTAAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18255R-1.in silico     301 GTCAAAGTGGGCACCCGGACACGCCTCCTAACCGAAATACGCAGCTCAACAGATCTTAAG 360


18255R-1.IR_full       361 CTAACCTGGGTACAGAAATGATCGGAGAGTGTGCGCAAACGACCGGATCACGGAAGTCAA 420
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
18255R-1.in silico     361 CTAACCT-GGTACAGAAATGATCGGAGAGTGTGCGCAAACGACCGGATCACGGAAGTCAA 420


18255R-1.IR_full       421 TGAAGGCACCTTCCACTACTTGGAGATTAGTCCCGTGACGCCTGGACGACGGTGGTCAGT 480
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
18255R-1.in silico     421 TGAAGGCACCTTCCACTACTTGGAGATTAGTCCCGTGACG-CTGGACGACGGTGGTCAGT 480


18255R-1.IR_full       481 GGATGCTAATGGCGGAGAACTT 502
                           ||||||||||||||||||||||
18255R-1.in silico     481 GGATGCTAATGGCGGAGAACTT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
100   482  NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_141004.1  CG3680-RA (CG3680), mRNA 
0   NM_130560.2  CG14789-RA (O-fut2), mRNA 
0   NM_137509.2  CG5482-RA (CG5482), mRNA 
0   NM_169499.1  CG8449-RA (CG8449), mRNA 
0   NM_142188.2  CG6276-RA (CG6276), mRNA 
0   NM_140872.1  CG9330-RA (CG9330), mRNA 
0   NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
0   NM_170054.2  CG17894-RB, transcript variant B (cnc), mRNA 
0   NM_167831.1  CG1228-RD, transcript variant D (Ptpmeg), mRNA 
0   NM_167830.1  CG1228-RA, transcript variant A (Ptpmeg), mRNA 
0   NM_138187.2  CG1228-RC, transcript variant C (Ptpmeg), mRNA 
0   NM_166913.1  CG32801-RA (CG32801), mRNA 
0   NM_165581.1  CG11198-RB, transcript variant B (CG11198), mRNA 
0   NM_136498.1  CG11198-RA, transcript variant A (CG11198), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_140906.1  CG14182-RA (CG14182), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_167327.1  CG1848-RD, transcript variant D (LIMK1), mRNA 
0   NM_167326.1  CG1848-RA, transcript variant A (LIMK1), mRNA 
0   NM_078584.2  CG1848-RC, transcript variant C (LIMK1), mRNA 
0   NM_170368.1  CG31051-RA (CG31051), mRNA 
0   NM_136656.2  CG1868-RA, transcript variant A (CG1868), mRNA 
0   NM_165681.1  CG1868-RB, transcript variant B (CG1868), mRNA 
0   NM_142695.1  CG5810-RA (CG5810), mRNA 
0   NM_080516.1  CG16757-RA (Spn), mRNA 
0   NM_140803.1  CG14073-RB, transcript variant B (CG14073), mRNA 
0   NM_057278.3  CG7727-RA (Appl), mRNA 
0   NM_139439.2  CG15820-RA (CG15820), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.