National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18152R-1 
 Symbol CalpA  Full Name Calpain-A 
 CG No CG7563  Old CG No CG18152 
 Synonyms CG7563, EST C, CG18152, CalpA, Calpain-A, calpain, Calpain lacking calmodulin-like domain., Calpain, Calpain A 
 Accession No (Link to NCBI) NM_057700.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Park SH, Lee CW, Lee JH, Park JY, Roshandell M, Brennan CA, Choe KM.
Requirement for and polarized localization of integrin proteins during Drosophila wound closure.
Mol Biol Cell (2018) 29(18) 2137-2147 [ PubMed ID = 29995573 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGAGGGTTCTGCCCAGCATCA 
 Primer Seq. 3'
aatctagaggtaccCTCGTTCTTCTCCGTGGAGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NGAGGGTTCT GCCCAGCATC AAGAATATGA GAGTTCTGGG AGAGAAGAGC TCGAGCCTGG 
0061 GACCCTATTC CGAGGTGCAG GACTATGAGA CAATATTGAA CAGCTGCCTG GCCAGTGGTT 
0121 CCCTTTTCGA AGATCCACTT TTTCCGGCTT CGAACGAGTC TCTTCAGTTT TCCCGGCGTC 
0181 CAGATCGTCA CATCGAATGG CTGAGACCTC ATGAAATTGC CGAGAATCCC CAGTTTTTTG 
0241 TGGAGGGTTA TTCGCGTTTT GATGTTCAGC AAGGCGAGCT TGGTGACTGT TGGCTNCTTG 
0301 GCTNCCACAG CCAANTTTAA CTCAGGAATC CAACCTTTTC TTTCGGGTAA TTCCAGCGGA 
0361 ACAGAGTTTC GAGGAGAACT ATGCTGGTAT CTTCCATTTC CGCTTTTGGC AGTATGGTAA 
0421 ATGGGTTGAT GTAATCATTG ATGACCGTTT GCCCACTTAT AATGGAGAGC TGATGTACAT 
0481 GCACTCCACG GAGAAGAACG AG 
 in silico PCR Fragment
0001 AGAGGGTTCT GCCCAGCATC AAGAATATGA GAGTTCTGGG AGAGAAGAGC TCGAGCCTGG 
0061 GACCCTATTC CGAGGTGCAG GACTATGAGA CAATATTGAA CAGCTGCCTG GCCAGTGGTT 
0121 CCCTTTTCGA AGATCCACTT TTTCCGGCTT CGAACGAGTC TCTTCAGTTT TCCCGGCGTC 
0181 CAGATCGTCA CATCGAATGG CTGAGACCTC ATGAAATTGC CGAGAATCCC CAGTTTTTTG 
0241 TGGAGGGTTA TTCGCGTTTT GATGTTCAGC AAGGCGAGCT TGGTGACTGT TGGCT-CTTG 
0301 GCTGCCACAG CCAA-TTTAA CTCAGGAATC CAACCTTTTC TTTCGGGTAA TTCCAGCGGA 
0361 ACAGAGTTTC GAGGAGAACT ATGCTGGTAT CTTCCATTTC CGCTTTTGGC AGTATGGTAA 
0421 ATGGGTTGAT GTAATCATTG ATGACCGTTT GCCCACTTAT AATGGAGAGC TGATGTACAT 
0481 GCACTCCACG GAGAAGAACG AG 
 Assemble Data

18152R-1.IR_full        1   GAGGGTTCTGCCCAGCATCAAGAATATGAGAGTTCTGGGAGAGAAGAGCTCGAGCCTGG 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18152R-1.in silico      1   GAGGGTTCTGCCCAGCATCAAGAATATGAGAGTTCTGGGAGAGAAGAGCTCGAGCCTGG 59


18152R-1.IR_full       61  GACCCTATTCCGAGGTGCAGGACTATGAGACAATATTGAACAGCTGCCTGGCCAGTGGTT 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18152R-1.in silico     61  GACCCTATTCCGAGGTGCAGGACTATGAGACAATATTGAACAGCTGCCTGGCCAGTGGTT 119


18152R-1.IR_full       121 CCCTTTTCGAAGATCCACTTTTTCCGGCTTCGAACGAGTCTCTTCAGTTTTCCCGGCGTC 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18152R-1.in silico     121 CCCTTTTCGAAGATCCACTTTTTCCGGCTTCGAACGAGTCTCTTCAGTTTTCCCGGCGTC 179


18152R-1.IR_full       181 CAGATCGTCACATCGAATGGCTGAGACCTCATGAAATTGCCGAGAATCCCCAGTTTTTTG 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18152R-1.in silico     181 CAGATCGTCACATCGAATGGCTGAGACCTCATGAAATTGCCGAGAATCCCCAGTTTTTTG 239


18152R-1.IR_full       241 TGGAGGGTTATTCGCGTTTTGATGTTCAGCAAGGCGAGCTTGGTGACTGTTGGCTNCTTG 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
18152R-1.in silico     241 TGGAGGGTTATTCGCGTTTTGATGTTCAGCAAGGCGAGCTTGGTGACTGTTGGCT-CTTG 299


18152R-1.IR_full       301 GCTNCCACAGCCAANTTTAACTCAGGAATCCAACCTTTTCTTTCGGGTAATTCCAGCGGA 359
                           ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||
18152R-1.in silico     301 GCTGCCACAGCCAA-TTTAACTCAGGAATCCAACCTTTTCTTTCGGGTAATTCCAGCGGA 359


18152R-1.IR_full       361 ACAGAGTTTCGAGGAGAACTATGCTGGTATCTTCCATTTCCGCTTTTGGCAGTATGGTAA 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18152R-1.in silico     361 ACAGAGTTTCGAGGAGAACTATGCTGGTATCTTCCATTTCCGCTTTTGGCAGTATGGTAA 419


18152R-1.IR_full       421 ATGGGTTGATGTAATCATTGATGACCGTTTGCCCACTTATAATGGAGAGCTGATGTACAT 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18152R-1.in silico     421 ATGGGTTGATGTAATCATTGATGACCGTTTGCCCACTTATAATGGAGAGCTGATGTACAT 479


18152R-1.IR_full       481 GCACTCCACGGAGAAGAACGAG 501
                           ||||||||||||||||||||||
18152R-1.in silico     481 GCACTCCACGGAGAAGAACGAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057699.3  CG7563-RB, transcript variant B (CalpA), mRNA 
100   482  NM_057700.3  CG7563-RA, transcript variant A (CalpA), mRNA 
1.86   31  41  NM_079292.4  CG8107-RA (CalpB), mRNA 
0   NM_001014652.1  CG10693-RP, transcript variant P (slo), mRNA 
0   NM_001014651.1  CG10693-RQ, transcript variant Q (slo), mRNA 
0   NM_001014663.1  CG10693-RE, transcript variant E (slo), mRNA 
0   NM_001014664.1  CG10693-RD, transcript variant D (slo), mRNA 
0   NM_001014653.1  CG10693-RO, transcript variant O (slo), mRNA 
0   NM_001014660.1  CG10693-RH, transcript variant H (slo), mRNA 
0   NM_001014658.1  CG10693-RJ, transcript variant J (slo), mRNA 
0   NM_001014659.1  CG10693-RI, transcript variant I (slo), mRNA 
0   NM_001014656.1  CG10693-RL, transcript variant L (slo), mRNA 
0   NM_001014657.1  CG10693-RK, transcript variant K (slo), mRNA 
0   NM_079762.2  CG10693-RA, transcript variant A (slo), mRNA 
0   NM_001014661.1  CG10693-RG, transcript variant G (slo), mRNA 
0   NM_001014655.1  CG10693-RM, transcript variant M (slo), mRNA 
0   NM_001014654.1  CG10693-RN, transcript variant N (slo), mRNA 
0   NM_001014662.1  CG10693-RF, transcript variant F (slo), mRNA 
0   NM_206566.1  CG10693-RC, transcript variant C (slo), mRNA 
0   NM_170164.1  CG10693-RB, transcript variant B (slo), mRNA 
0   NM_142190.2  CG4931-RA (Sra-1), mRNA 
0   NM_167003.1  CG32775-RA (GlcAT-I), mRNA 
0   NM_057386.3  CG6137-RA (aub), mRNA 
0   NM_080307.1  CG3206-RA (Or2a), mRNA 
0   NM_169496.1  CG8141-RA (CG8141), mRNA 
0   NM_001043295.1  CG34129-RA (CG34129), mRNA 
0   NM_079383.2  CG4531-RA (argos), mRNA 
0   NM_176494.2  CG10851-RG, transcript variant G (B52), mRNA 
0   NM_176493.2  CG10851-RF, transcript variant F (B52), mRNA 
0   NM_176492.2  CG10851-RD, transcript variant D (B52), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.