National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18012R-2 
 Symbol CG18012  Full Name CG18012 
 CG No CG18012  Old CG No CG18012 
 Synonyms CG18012 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCGGAAGTGCTGCCCAAG 
 Primer Seq. 3'
aatctagaggtaccTGTGCCTTGGAGCCGAAGTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

18012R-2.IR full       1   CGATGGCGGAAGTGCTGCCCAAGAAGCGCAACGC-TGCGTCATCGTGCTGGGCGACATTG 60
                             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
18012R-2.in silico     1   --ATGGCGGAAGTGCTGCCCAAGAAGCGCAACGCCTGCGTCATCGTGCTGGGCGACATTG 60


18012R-2.IR full       61  GACGCAGTCCGCGCGTGCAGTACCATGCCCAGAGTCTTCTCGAGGAGAACTACCACGTGG 120
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
18012R-2.in silico     61  GACGCAGTCCGCGCATGCAGTACCATGCCCAGAGTCTTCTCGAGGAGAACTACCACGTGG 120


18012R-2.IR full       121 ACATGATTGGGTATCTGGAGACGAGGCCGCTGGAGGAACTGACTCAACATCCACGTTGCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18012R-2.in silico     121 ACATGATTGGGTATCTGGAGACGAGGCCGCTGGAGGAACTGACTCAACATCCACGTTGCC 180


18012R-2.IR full       181 GAATCCACGAGCTAACTGCCGTCCCAGTGACGAACCTAACACCCAAACTGCGCCTGCTCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18012R-2.in silico     181 GAATCCACGAGCTAACTGCCGTCCCAGTGACGAACCTAACACCCAAACTGCGCCTGCTCT 240


18012R-2.IR full       241 TCAAGGCCTTTTGNCAGACGCTCAGTCTGCTGATGGCTCTCATCTCCATTGGCCGTCCCA 300
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
18012R-2.in silico     241 TCAAGGCCTTTTGGCAGACGCTCAGTCTGCTGATGGCTCTCATCTCCATTGGCCGTCCCA 300


18012R-2.IR full       301 GCTTCCTACTCGTCCAGAATCCGCCCGGCATTCCCACGCTGATTGTGTGCTATCTGTACT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18012R-2.in silico     301 GCTTCCTACTCGTCCAGAATCCGCCCGGCATTCCCACGCTGATTGTGTGCTATCTGTACT 360


18012R-2.IR full       361 GTGCGGTCACACGAACCAAGCTGGCCATCGATTGGCACAACTACACGTACACAGTGCTGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18012R-2.in silico     361 GTGCGGTCACACGAACCAAGCTGGCCATCGATTGGCACAACTACACGTACACAGTGCTGG 420


18012R-2.IR full       421 CATTGGGAATGTCGAAGGGAGAGCAGAGTCCTCTAATACGATTGGTTAGGCGACTGGAGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18012R-2.in silico     421 CATTGGGAATGTCGAAGGGAGAGCAGAGTCCTCTAATACGATTGGTTAGGCGACTGGAGC 480


18012R-2.IR full       481 GATACTTCGGCTCCAAGGCACA 502
                           ||||||||||||||||||||||
18012R-2.in silico     481 GATACTTCGGCTCCAAGGCACA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_142405.1  CG18012-RA (CG18012), mRNA 
NM_164716.1  CG31632-RA (CG31632), mRNA 
12  NM_166546.2  jitterbug CG30092-RD, transcript variant D (jbug), mRNA 
12  NM_166548.2  jitterbug CG30092-RB, transcript variant B (jbug), mRNA 
NM_166550.1  jitterbug CG30092-RC, transcript variant C (jbug), mRNA 
NM_142296.2  CG14899-RA (CG14899), mRNA 
NM_142273.2  CG12785-RA (CG12785), mRNA 
NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
NM_137006.2  CG4663-RA (CG4663), mRNA 
NM_143483.1  Ribosomal protein S8 CG7808-RC (RpS8), mRNA 
NM_143781.2  lethal (2) 08717 CG15095-RA, transcript variant A (l(2)08717), mRNA 
NM_166309.1  lethal (2) 08717 CG15095-RB, transcript variant B (l(2)08717), mRNA 
NM_079170.2  Shaker cognate b CG1066-RB, transcript variant B (Shab), mRNA 
NM_167967.1  Shaker cognate b CG1066-RA, transcript variant A (Shab), mRNA 
NM_001043115.1  Shaker cognate b CG1066-RC, transcript variant C (Shab), mRNA 
NM_080121.2  greatwall CG7719-RA (gwl), mRNA 
NM_167194.1  Hexokinase A CG3001-RB, transcript variant B (Hex-A), mRNA 
NM_080109.2  Hexokinase A CG3001-RA, transcript variant A (Hex-A), mRNA 
NM_142699.1  CG5871-RA (CG5871), mRNA 
NM_136179.1  CG10721-RA (CG10721), mRNA 
NM_141813.2  ninaG CG6728-RA (ninaG), mRNA 
NM_170340.1  widerborst CG5643-RF, transcript variant F (wdb), mRNA 
NM_170337.1  widerborst CG5643-RB, transcript variant B (wdb), mRNA 
NM_170338.1  widerborst CG5643-RD, transcript variant D (wdb), mRNA 
NM_170341.1  widerborst CG5643-RG, transcript variant G (wdb), mRNA 
NM_170336.1  widerborst CG5643-RA, transcript variant A (wdb), mRNA 
NM_143312.2  widerborst CG5643-RC, transcript variant C (wdb), mRNA 
NM_170339.1  widerborst CG5643-RE, transcript variant E (wdb), mRNA 
NM_143278.1  CG6074-RA (CG6074), mRNA 
NM_143004.1  CG13615-RA (CG13615), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.