National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18012R-1 
 Symbol CG18012  Full Name CG18012 
 CG No CG18012  Old CG No CG18012 
 Synonyms CG18012 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCGGAAGTGCTGCCCAAG 
 Primer Seq. 3'
aatctagaggtaccTGTGCCTTGGAGCCGAAGTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGATGGCGGA AGTGCTGCCC AAGAAGCGCA ACGC-TGCGT CATCGTGCTG GGCGACATTG 
0061 GACGCAGTCC GCGCGTGCAG TACCATGCCC AGAGTCTTCT CGAGGAGAAC TACCACGTGG 
0121 ACATGATTGG GTATCTGGAG ACGAGGCCGC TGGAGGAACT GACTCAACAT CCACGTTGCC 
0181 GAATCCACGA GCTAACTGCC GTCCCAGTGA CGAACCTAAC ACCCAAACTG CGCCTGCTCT 
0241 TCAAGGCCTT TTGNCAGACG CTCAGTCTGC TGATGGCTCT CATCTCCATT GGCCGTCCCA 
0301 GCTTCCTACT CGTCCAGAAT CCGCCCGGCA TTCCCACGCT GATTGTGTGC TATCTGTACT 
0361 GTGCGGTCAC ACGAACCAAG CTGGCCATCG ATTGGCACAA CTACACGTAC ACAGTGCTGG 
0421 CATTGGGAAT GTCGAAGGGA GAGCAGAGTC CTCTAATACG ATTGGTTAGG CGACTGGAGC 
0481 GATACTTCGG CTCCAAGGCA CA 
 in silico PCR Fragment
0001 atggcggaag tgctgcccaa gaagcgcaac gcctgcgtca tcgtgctggg cgacattgga 
0061 cgcagtccgc gcatgcagta ccatgcccag agtcttctcg aggagaacta ccacgtggac 
0121 atgattgggt atctggagac gaggccgctg gaggaactga ctcaacatcc acgttgccga 
0181 atccacgagc taactgccgt cccagtgacg aacctaacac ccaaactgcg cctgctcttc 
0241 aaggcctttt ggcagacgct cagtctgctg atggctctca tctccattgg ccgtcccagc 
0301 ttcctactcg tccagaatcc gcccggcatt cccacgctga ttgtgtgcta tctgtactgt 
0361 gcggtcacac gaaccaagct ggccatcgat tggcacaact acacgtacac agtgctggca 
0421 ttgggaatgt cgaagggaga gcagagtcct ctaatacgat tggttaggcg actggagcga 
0481 tacttcggct ccaaggcaca  
 Assemble Data

18012R-1.IR full       1   CGATGGCGGAAGTGCTGCCCAAGAAGCGCAACGC-TGCGTCATCGTGCTGGGCGACATTG 60
                             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
18012R-1.in silico     1   --ATGGCGGAAGTGCTGCCCAAGAAGCGCAACGCCTGCGTCATCGTGCTGGGCGACATTG 60


18012R-1.IR full       61  GACGCAGTCCGCGCGTGCAGTACCATGCCCAGAGTCTTCTCGAGGAGAACTACCACGTGG 120
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
18012R-1.in silico     61  GACGCAGTCCGCGCATGCAGTACCATGCCCAGAGTCTTCTCGAGGAGAACTACCACGTGG 120


18012R-1.IR full       121 ACATGATTGGGTATCTGGAGACGAGGCCGCTGGAGGAACTGACTCAACATCCACGTTGCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18012R-1.in silico     121 ACATGATTGGGTATCTGGAGACGAGGCCGCTGGAGGAACTGACTCAACATCCACGTTGCC 180


18012R-1.IR full       181 GAATCCACGAGCTAACTGCCGTCCCAGTGACGAACCTAACACCCAAACTGCGCCTGCTCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18012R-1.in silico     181 GAATCCACGAGCTAACTGCCGTCCCAGTGACGAACCTAACACCCAAACTGCGCCTGCTCT 240


18012R-1.IR full       241 TCAAGGCCTTTTGNCAGACGCTCAGTCTGCTGATGGCTCTCATCTCCATTGGCCGTCCCA 300
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
18012R-1.in silico     241 TCAAGGCCTTTTGGCAGACGCTCAGTCTGCTGATGGCTCTCATCTCCATTGGCCGTCCCA 300


18012R-1.IR full       301 GCTTCCTACTCGTCCAGAATCCGCCCGGCATTCCCACGCTGATTGTGTGCTATCTGTACT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18012R-1.in silico     301 GCTTCCTACTCGTCCAGAATCCGCCCGGCATTCCCACGCTGATTGTGTGCTATCTGTACT 360


18012R-1.IR full       361 GTGCGGTCACACGAACCAAGCTGGCCATCGATTGGCACAACTACACGTACACAGTGCTGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18012R-1.in silico     361 GTGCGGTCACACGAACCAAGCTGGCCATCGATTGGCACAACTACACGTACACAGTGCTGG 420


18012R-1.IR full       421 CATTGGGAATGTCGAAGGGAGAGCAGAGTCCTCTAATACGATTGGTTAGGCGACTGGAGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18012R-1.in silico     421 CATTGGGAATGTCGAAGGGAGAGCAGAGTCCTCTAATACGATTGGTTAGGCGACTGGAGC 480


18012R-1.IR full       481 GATACTTCGGCTCCAAGGCACA 502
                           ||||||||||||||||||||||
18012R-1.in silico     481 GATACTTCGGCTCCAAGGCACA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_142405.1  CG18012-RA (CG18012), mRNA 
NM_164716.1  CG31632-RA (CG31632), mRNA 
12  NM_166546.2  jitterbug CG30092-RD, transcript variant D (jbug), mRNA 
12  NM_166548.2  jitterbug CG30092-RB, transcript variant B (jbug), mRNA 
NM_166550.1  jitterbug CG30092-RC, transcript variant C (jbug), mRNA 
NM_142296.2  CG14899-RA (CG14899), mRNA 
NM_142273.2  CG12785-RA (CG12785), mRNA 
NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
NM_137006.2  CG4663-RA (CG4663), mRNA 
NM_143483.1  Ribosomal protein S8 CG7808-RC (RpS8), mRNA 
NM_143781.2  lethal (2) 08717 CG15095-RA, transcript variant A (l(2)08717), mRNA 
NM_166309.1  lethal (2) 08717 CG15095-RB, transcript variant B (l(2)08717), mRNA 
NM_079170.2  Shaker cognate b CG1066-RB, transcript variant B (Shab), mRNA 
NM_167967.1  Shaker cognate b CG1066-RA, transcript variant A (Shab), mRNA 
NM_001043115.1  Shaker cognate b CG1066-RC, transcript variant C (Shab), mRNA 
NM_080121.2  greatwall CG7719-RA (gwl), mRNA 
NM_167194.1  Hexokinase A CG3001-RB, transcript variant B (Hex-A), mRNA 
NM_080109.2  Hexokinase A CG3001-RA, transcript variant A (Hex-A), mRNA 
NM_142699.1  CG5871-RA (CG5871), mRNA 
NM_136179.1  CG10721-RA (CG10721), mRNA 
NM_141813.2  ninaG CG6728-RA (ninaG), mRNA 
NM_170340.1  widerborst CG5643-RF, transcript variant F (wdb), mRNA 
NM_170337.1  widerborst CG5643-RB, transcript variant B (wdb), mRNA 
NM_170338.1  widerborst CG5643-RD, transcript variant D (wdb), mRNA 
NM_170341.1  widerborst CG5643-RG, transcript variant G (wdb), mRNA 
NM_170336.1  widerborst CG5643-RA, transcript variant A (wdb), mRNA 
NM_143312.2  widerborst CG5643-RC, transcript variant C (wdb), mRNA 
NM_170339.1  widerborst CG5643-RE, transcript variant E (wdb), mRNA 
NM_143278.1  CG6074-RA (CG6074), mRNA 
NM_143004.1  CG13615-RA (CG13615), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.