National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1799R-3 
 Symbol ras  Full Name raspberry 
 CG No CG1799  Old CG No CG1799 
 Synonyms IMPdH, CG11485, LD06825, LD02673, EP(X)1093, IMPDH, raspberry/impd, l(1)G0002, l(1)G0482, l(1)G0098, l(1)G0351, l(1)G0388, l(1)G0391, l(1)G0436, l(1)G0238, l(1)G0056, l(1)G0127, l(1)G0380, ras-l, l(1)9Eb, CG1799, ras 
 Accession No (Link to NCBI) NM_167240.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Johnson C, Chun-Jen Lin C, Stern M.
Ras-dependent and Ras-independent effects of PI3K inĀ Drosophila motor neurons.
Genes Brain Behav (2012) 11(7) 848-58 [ PubMed ID = 22783951 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGAAGGTGAACGGCTTTGTG 
 Primer Seq. 3'
aatctagaggtaccCCAAGTTTGCCGTTCTCGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGAAGGTGA ACGGCTTTGT GGAATCGACG TCGTCTTCAG CGGCGCCGGC AATCCAGACA 
0061 AAGAGTACCA CCGGATTCGA TGCCGAGCTG CAGGATGGGC TGAGTTGTAA GGAACTGTTC 
0121 CAGAACGGTG AGGGACTCAC CTACAACGAC TTTCTCATAC TGCCCGGCTA CATAGACTTC 
0181 ACCGCCGAGG AGGTCGATCT CAGTTCGCCA CTGACCAAGT CGCTGACATT GCGAGCACCG 
0241 CTGGTTAGTT CGCCCATGGA CACGGTAACC GAATCGGAGA TGGCCATCGC CATGGCGCTG 
0301 TGTGGTGGCA TTGGCATCAT CCATCACAAC TGCACGCCGG AATACCAGGC GTTGGAGGTG 
0361 CACAAGGTTA AGAAGTACAA GCACGGCTTC ATGCGCGACC CCTCGGTGAT GTCGCCCACG 
0421 AATACGGTGG GGGATGTGTT GGAGGCGCGG CGGAAGAACG GATTCACCGG CTATCCGGTC 
0481 ACCGAGAACG GCAAACTTGG  
 in silico PCR Fragment
0001 GTGAAGGTGA ACGGCTTTGT GGAATCGACG TCGTCTTCAG CGGCGCCGGC AATCCAGACA 
0061 AAGAGTACCA CCGGATTCGA TGCCGAGCTG CAGGATGGGC TGAGTTGTAA GGAACTGTTC 
0121 CAGAACGGTG AGGGACTCAC CTACAACGAC TTTCTCATAC TGCCCGGCTA CATAGACTTC 
0181 ACCGCCGAGG AGGTCGATCT CAGTTCGCCA CTGACCAAGT CGCTGACATT GCGAGCACCG 
0241 CTGGTTAGTT CGCCCATGGA CACGGTAACC GAATCGGAGA TGGCCATCGC CATGGCGCTG 
0301 TGTGGTGGCA TTGGCATCAT CCATCACAAC TGCACGCCGG AATACCAGGC GTTGGAGGTG 
0361 CACAAGGTTA AGAAGTACAA GCACGGCTTC ATGCGCGACC CCTCGGTGAT GTCGCCCACG 
0421 AATACGGTGG GGGATGTGTT GGAGGCGCGG CGGAAGAACG GATTCACCGG CTATCCGGTC 
0481 ACCGAGAACG GCAAACTTGG  
 Assemble Data

1799R-3.IR_full       1   GTGAAGGTGAACGGCTTTGTGGAATCGACGTCGTCTTCAGCGGCGCCGGCAATCCAGACA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1799R-3.in silico     1   GTGAAGGTGAACGGCTTTGTGGAATCGACGTCGTCTTCAGCGGCGCCGGCAATCCAGACA 60


1799R-3.IR_full       61  AAGAGTACCACCGGATTCGATGCCGAGCTGCAGGATGGGCTGAGTTGTAAGGAACTGTTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1799R-3.in silico     61  AAGAGTACCACCGGATTCGATGCCGAGCTGCAGGATGGGCTGAGTTGTAAGGAACTGTTC 120


1799R-3.IR_full       121 CAGAACGGTGAGGGACTCACCTACAACGACTTTCTCATACTGCCCGGCTACATAGACTTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1799R-3.in silico     121 CAGAACGGTGAGGGACTCACCTACAACGACTTTCTCATACTGCCCGGCTACATAGACTTC 180


1799R-3.IR_full       181 ACCGCCGAGGAGGTCGATCTCAGTTCGCCACTGACCAAGTCGCTGACATTGCGAGCACCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1799R-3.in silico     181 ACCGCCGAGGAGGTCGATCTCAGTTCGCCACTGACCAAGTCGCTGACATTGCGAGCACCG 240


1799R-3.IR_full       241 CTGGTTAGTTCGCCCATGGACACGGTAACCGAATCGGAGATGGCCATCGCCATGGCGCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1799R-3.in silico     241 CTGGTTAGTTCGCCCATGGACACGGTAACCGAATCGGAGATGGCCATCGCCATGGCGCTG 300


1799R-3.IR_full       301 TGTGGTGGCATTGGCATCATCCATCACAACTGCACGCCGGAATACCAGGCGTTGGAGGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1799R-3.in silico     301 TGTGGTGGCATTGGCATCATCCATCACAACTGCACGCCGGAATACCAGGCGTTGGAGGTG 360


1799R-3.IR_full       361 CACAAGGTTAAGAAGTACAAGCACGGCTTCATGCGCGACCCCTCGGTGATGTCGCCCACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1799R-3.in silico     361 CACAAGGTTAAGAAGTACAAGCACGGCTTCATGCGCGACCCCTCGGTGATGTCGCCCACG 420


1799R-3.IR_full       421 AATACGGTGGGGGATGTGTTGGAGGCGCGGCGGAAGAACGGATTCACCGGCTATCCGGTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1799R-3.in silico     421 AATACGGTGGGGGATGTGTTGGAGGCGCGGCGGAAGAACGGATTCACCGGCTATCCGGTC 480


1799R-3.IR_full       481 ACCGAGAACGGCAAACTTGG 500
                          ||||||||||||||||||||
1799R-3.in silico     481 ACCGAGAACGGCAAACTTGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167240.1  CG1799-RA, transcript variant A (ras), mRNA 
100   482  NM_167241.1  CG1799-RC, transcript variant C (ras), mRNA 
92.32   445  NM_079907.4  CG1799-RB, transcript variant B (ras), mRNA 
0   NM_132114.1  CG14442-RA (CG14442), mRNA 
0   NM_176247.1  CG33143-RB, transcript variant B (CG33143), mRNA 
0   NM_176246.1  CG33143-RC, transcript variant C (CG33143), mRNA 
0   NM_080315.2  CG10742-RA (Tsp3A), mRNA 
0   NM_139800.2  CG8549-RA (CG8549), mRNA 
0   NM_132096.3  CG3342-RA (CG3342), mRNA 
0   NM_165855.1  CG8979-RC, transcript variant C (CG8979), mRNA 
0   NM_165854.1  CG8979-RB, transcript variant B (CG8979), mRNA 
0   NM_136871.2  CG8979-RA, transcript variant A (CG8979), mRNA 
0   NM_078494.2  CG3201-RA (Mlc-c), mRNA 
0   NM_168229.1  CG32373-RA, transcript variant A (CG32373), mRNA 
0   NM_206297.1  CG32373-RB, transcript variant B (CG32373), mRNA 
0   NM_165450.1  CG7882-RA, transcript variant A (CG7882), mRNA 
0   NM_136345.1  CG7882-RB, transcript variant B (CG7882), mRNA 
0   NM_001015363.1  CG40064-PA (CG40064), mRNA 
0   NM_078543.2  CG15793-RA (Dsor1), mRNA 
0   NM_142054.1  CG14365-RA (CG14365), mRNA 
0   NM_080016.2  CG4481-RA (Glu-RIB), mRNA 
0   NM_079764.2  CG6875-RA (asp), mRNA 
0   NM_164490.1  CG9884-RC, transcript variant C (oaf), mRNA 
0   NM_164489.1  CG9884-RB, transcript variant B (oaf), mRNA 
0   NM_001038822.1  CG31732-RG, transcript variant G (yuri), mRNA 
0   NM_001038820.1  CG31732-RE, transcript variant E (yuri), mRNA 
0   NM_001038821.1  CG31732-RF, transcript variant F (yuri), mRNA 
0   NM_165106.4  CG31732-RB, transcript variant B (yuri), mRNA 
0   NM_175949.1  CG9884-RD, transcript variant D (oaf), mRNA 
0   NM_057692.2  CG9884-RA, transcript variant A (oaf), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.