National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17870R-2 
 Symbol 14-3-3zeta  Full Name 14-3-3zeta 
 CG No CG17870  Old CG No CG17870 
 Synonyms leo, 14-3-3, PAR5, d14-3-3zeta, par-5, Par-5, CG17870, 4-3-3 zeta, D14-3-3zeta, 14-3-3zeta, unnamed, 549, 2G1, 5.11, K, BEST:GH05075, l(2)07103, D14-3-3, l(2)46Ee, l(2)46CFe 
 Accession No (Link to NCBI) NM_165741.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal, female semi-lethal 
 Map Viewer
[Please submit your publication]
Le TP, Vuong LT, Kim AR, Hsu YC, Choi KW.
14-3-3 proteins regulate Tctp-Rheb interaction for organ growth in Drosophila.
Nat Commun (2016) 7 11501 [ PubMed ID = 27151460 ] [ RRC reference ]

Ulvila J, Vanha-aho LM, Kleino A, Vähä-Mäkilä M, Vuoksio M, Eskelinen S, Hultmark D, Kocks C, Hallman M, Parikka M, Rämet M.
Cofilin regulator 14-3-3zeta is an evolutionarily conserved protein required for phagocytosis and microbial resistance.
J. Leukoc. Biol. (2011) 89(5) 649-59 [ PubMed ID = 21208897 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCGACAGTCGATAAGGAAGAGCTGGTCCAGAAGGCTAAACTGGCCGAGCAGTCAGAACGT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TACGATGATATGGCCCAGGCCATGAAGTCCGTCACAGAGACTGGCGTTGAGCTCTCAAAT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAGGAAAGAAATCTGCTCTCCGTTGCCTACAAAAATGTGGTCGGTGCCCGCAGGTCATCG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGGCGTGTCATCTCCTCCATTGAGCAGAAAACCGAAGCATCCGCTAGAAAACAGCAGCTC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCCCGTGAGTACAGAGAGCGTGTGGAGAAGGAGCTGAGGGAAATCTGCTACGAAGTTTTG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGACTTCTGGACAAATACCTTATTCCAAAAGCCAGCAATCCCGAGAGCAAGGTGTTTTAC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTGAAGATGAAGGGTGATTACTACAGGTATTTAGCCGAGGTTGCCACAGGAGATGCACGC 420

                           |||||||| || ||||||||| |||  || || ||||| || || || |||   ||  || silico     421 AACACCGTCGTTGATGACTCGAAAAATGCCTATCAGGAGGCGTTCGATATTGCAAAAACC 480

17870R-2.IR_full       481 AAAATGCAGCCAACACATCC 500
                           |||||||||||||||||||| silico     481 AAAATGCAGCCAACACATCC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001014516.1  CG17870-RI, transcript variant I (14-3-3zeta), mRNA 
100   482  NM_165741.2  CG17870-RA, transcript variant A (14-3-3zeta), mRNA 
100   482  NM_165745.2  CG17870-RG, transcript variant G (14-3-3zeta), mRNA 
100   482  NM_206070.1  CG17870-RH, transcript variant H (14-3-3zeta), mRNA 
100   482  NM_165742.1  CG17870-RB, transcript variant B (14-3-3zeta), mRNA 
91.7   442  33  NM_165744.2  CG17870-RF, transcript variant F (14-3-3zeta), mRNA 
91.7   442  33  NM_165743.2  CG17870-RC, transcript variant C (14-3-3zeta), mRNA 
85.47   412  11  NM_057537.3  CG17870-RD, transcript variant D (14-3-3zeta), mRNA 
85.47   412  11  NM_001014515.1  CG17870-RJ, transcript variant J (14-3-3zeta), mRNA 
85.47   412  11  NM_165740.2  CG17870-RE, transcript variant E (14-3-3zeta), mRNA 
0   10  NM_135991.2  CG5020-RA, transcript variant A (CLIP-190), mRNA 
0   NM_136383.2  CG9422-RC, transcript variant C (CG9422), mRNA 
0   NM_165484.1  CG9422-RA, transcript variant A (CG9422), mRNA 
0   NM_142687.1  CG5793-RA (CG5793), mRNA 
0   NM_136017.2  CG15151-RA (PFE), mRNA 
0   NM_142864.1  CG17110-RA (CG17110), mRNA 
0   NM_079399.3  CG13726-RA (Or74a), mRNA 
0   NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0   NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0   NM_057661.2  CG5076-RA (elk), mRNA 
0   NM_142697.2  CG5862-RA (CG5862), mRNA 
0   NM_170395.1  CG1709-RB, transcript variant B (Vha100-1), mRNA 
0   NM_170397.1  CG1709-RH, transcript variant H (Vha100-1), mRNA 
0   NM_139795.1  CG10124-RA (eIF4E-4), mRNA 
0   NM_143415.2  CG1709-RE, transcript variant E (Vha100-1), mRNA 
0   NM_170392.1  CG1709-RA, transcript variant A (Vha100-1), mRNA 
0   NM_170396.1  CG1709-RD, transcript variant D (Vha100-1), mRNA 
0   NM_170391.1  CG1709-RC, transcript variant C (Vha100-1), mRNA 
0   NM_170394.1  CG1709-RG, transcript variant G (Vha100-1), mRNA 
0   NM_170393.1  CG1709-RF, transcript variant F (Vha100-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.