National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17870R-1 
 Symbol 14-3-3zeta  Full Name 14-3-3zeta 
 CG No CG17870  Old CG No CG17870 
 Synonyms leo, 14-3-3, PAR5, d14-3-3zeta, par-5, Par-5, CG17870, 4-3-3 zeta, D14-3-3zeta, 14-3-3zeta, unnamed, 549, 2G1, 5.11, K, BEST:GH05075, l(2)07103, D14-3-3, l(2)46Ee, l(2)46CFe 
 Accession No (Link to NCBI) NM_165741.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ulvila J, Vanha-aho LM, Kleino A, Vähä-Mäkilä M, Vuoksio M, Eskelinen S, Hultmark D, Kocks C, Hallman M, Parikka M, Rämet M.
Cofilin regulator 14-3-3zeta is an evolutionarily conserved protein required for phagocytosis and microbial resistance.
J. Leukoc. Biol. (2011) 89(5) 649-59 [ PubMed ID = 21208897 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGACAGTCGATAAGGAAGAG 
 Primer Seq. 3'
aatctagaggtaccGGATGTGTTGGCTGCATTTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGACAGTCG ATAAGGAAGA GCTGGTCCAG AAGGCTAAAC TGGCCGAGCA GTCAGAACGT 
0061 TACGATGATA TGGCCCAGGC CATGAAGTCC GTCACAGAGA CTGGCGTTGA GCTCTCAAAT 
0121 GAGGAAAGAA ATCTGCTCTC CGTTGCCTAC AAAAATGTGG TCGGTGCCCG CAGGTCATCG 
0181 TGGCGTGTCA TCTCCTCCAT TGAGCAGAAA ACCGAAGCAT CCGCTAGAAA ACAGCAGCTC 
0241 GCCCGTGAGT ACAGAGAGCG TGTGGAGAAG GAGCTGAGGG AAATCTGCTA CGAAGTTTTG 
0301 GGACTTCTGG ACAAATACCT TATTCCAAAA GCCAGCAATC CCGAGAGCAA GGTGTTTTAC 
0361 CTGAAGATGA AGGGTGATTA CTACAGGTAT TTAGCCGAGG TTGCCACAGG AGATGCACGC 
0421 AACACCGTTG TCGATGACTC GCAAACCGCT TACCAGGATG CATTTGACAT TAGCAAGGCC 
0481 AAAATGCAGC CAACACATCC  
 in silico PCR Fragment
0001 TCGACAGTCG ATAAGGAAGA GCTGGTCCAG AAGGCTAAAC TGGCCGAGCA GTCAGAACGT 
0061 TACGATGATA TGGCCCAGGC CATGAAGTCC GTCACAGAGA CTGGCGTTGA GCTCTCAAAT 
0121 GAGGAAAGAA ATCTGCTCTC CGTTGCCTAC AAAAATGTGG TCGGTGCCCG CAGGTCATCG 
0181 TGGCGTGTCA TCTCCTCCAT TGAGCAGAAA ACCGAAGCAT CCGCTAGAAA ACAGCAGCTC 
0241 GCCCGTGAGT ACAGAGAGCG TGTGGAGAAG GAGCTGAGGG AAATCTGCTA CGAAGTTTTG 
0301 GGACTTCTGG ACAAATACCT TATTCCAAAA GCCAGCAATC CCGAGAGCAA GGTGTTTTAC 
0361 CTGAAGATGA AGGGTGATTA CTACAGGTAT TTAGCCGAGG TTGCCACAGG AGATGCACGC 
0421 AACACCGTCG TTGATGACTC GAAAAATGCC TATCAGGAGG CGTTCGATAT TGCAAAAACC 
0481 AAAATGCAGC CAACACATCC  
 Assemble Data

17870R-1.IR_full       1   TCGACAGTCGATAAGGAAGAGCTGGTCCAGAAGGCTAAACTGGCCGAGCAGTCAGAACGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17870R-1.in silico     1   TCGACAGTCGATAAGGAAGAGCTGGTCCAGAAGGCTAAACTGGCCGAGCAGTCAGAACGT 60


17870R-1.IR_full       61  TACGATGATATGGCCCAGGCCATGAAGTCCGTCACAGAGACTGGCGTTGAGCTCTCAAAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17870R-1.in silico     61  TACGATGATATGGCCCAGGCCATGAAGTCCGTCACAGAGACTGGCGTTGAGCTCTCAAAT 120


17870R-1.IR_full       121 GAGGAAAGAAATCTGCTCTCCGTTGCCTACAAAAATGTGGTCGGTGCCCGCAGGTCATCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17870R-1.in silico     121 GAGGAAAGAAATCTGCTCTCCGTTGCCTACAAAAATGTGGTCGGTGCCCGCAGGTCATCG 180


17870R-1.IR_full       181 TGGCGTGTCATCTCCTCCATTGAGCAGAAAACCGAAGCATCCGCTAGAAAACAGCAGCTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17870R-1.in silico     181 TGGCGTGTCATCTCCTCCATTGAGCAGAAAACCGAAGCATCCGCTAGAAAACAGCAGCTC 240


17870R-1.IR_full       241 GCCCGTGAGTACAGAGAGCGTGTGGAGAAGGAGCTGAGGGAAATCTGCTACGAAGTTTTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17870R-1.in silico     241 GCCCGTGAGTACAGAGAGCGTGTGGAGAAGGAGCTGAGGGAAATCTGCTACGAAGTTTTG 300


17870R-1.IR_full       301 GGACTTCTGGACAAATACCTTATTCCAAAAGCCAGCAATCCCGAGAGCAAGGTGTTTTAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17870R-1.in silico     301 GGACTTCTGGACAAATACCTTATTCCAAAAGCCAGCAATCCCGAGAGCAAGGTGTTTTAC 360


17870R-1.IR_full       361 CTGAAGATGAAGGGTGATTACTACAGGTATTTAGCCGAGGTTGCCACAGGAGATGCACGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17870R-1.in silico     361 CTGAAGATGAAGGGTGATTACTACAGGTATTTAGCCGAGGTTGCCACAGGAGATGCACGC 420


17870R-1.IR_full       421 AACACCGTTGTCGATGACTCGCAAACCGCTTACCAGGATGCATTTGACATTAGCAAGGCC 480
                           |||||||| || ||||||||| |||  || || ||||| || || || |||   ||  ||
17870R-1.in silico     421 AACACCGTCGTTGATGACTCGAAAAATGCCTATCAGGAGGCGTTCGATATTGCAAAAACC 480


17870R-1.IR_full       481 AAAATGCAGCCAACACATCC 500
                           ||||||||||||||||||||
17870R-1.in silico     481 AAAATGCAGCCAACACATCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001014516.1  CG17870-RI, transcript variant I (14-3-3zeta), mRNA 
100   482  NM_165741.2  CG17870-RA, transcript variant A (14-3-3zeta), mRNA 
100   482  NM_165745.2  CG17870-RG, transcript variant G (14-3-3zeta), mRNA 
100   482  NM_206070.1  CG17870-RH, transcript variant H (14-3-3zeta), mRNA 
100   482  NM_165742.1  CG17870-RB, transcript variant B (14-3-3zeta), mRNA 
91.7   442  33  NM_165744.2  CG17870-RF, transcript variant F (14-3-3zeta), mRNA 
91.7   442  33  NM_165743.2  CG17870-RC, transcript variant C (14-3-3zeta), mRNA 
85.47   412  11  NM_057537.3  CG17870-RD, transcript variant D (14-3-3zeta), mRNA 
85.47   412  11  NM_001014515.1  CG17870-RJ, transcript variant J (14-3-3zeta), mRNA 
85.47   412  11  NM_165740.2  CG17870-RE, transcript variant E (14-3-3zeta), mRNA 
0   10  NM_135991.2  CG5020-RA, transcript variant A (CLIP-190), mRNA 
0   NM_136383.2  CG9422-RC, transcript variant C (CG9422), mRNA 
0   NM_165484.1  CG9422-RA, transcript variant A (CG9422), mRNA 
0   NM_142687.1  CG5793-RA (CG5793), mRNA 
0   NM_136017.2  CG15151-RA (PFE), mRNA 
0   NM_142864.1  CG17110-RA (CG17110), mRNA 
0   NM_079399.3  CG13726-RA (Or74a), mRNA 
0   NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0   NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0   NM_057661.2  CG5076-RA (elk), mRNA 
0   NM_142697.2  CG5862-RA (CG5862), mRNA 
0   NM_170395.1  CG1709-RB, transcript variant B (Vha100-1), mRNA 
0   NM_170397.1  CG1709-RH, transcript variant H (Vha100-1), mRNA 
0   NM_139795.1  CG10124-RA (eIF4E-4), mRNA 
0   NM_143415.2  CG1709-RE, transcript variant E (Vha100-1), mRNA 
0   NM_170392.1  CG1709-RA, transcript variant A (Vha100-1), mRNA 
0   NM_170396.1  CG1709-RD, transcript variant D (Vha100-1), mRNA 
0   NM_170391.1  CG1709-RC, transcript variant C (Vha100-1), mRNA 
0   NM_170394.1  CG1709-RG, transcript variant G (Vha100-1), mRNA 
0   NM_170393.1  CG1709-RF, transcript variant F (Vha100-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.