National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17772R-1 
 Symbol oxt  Full Name peptide O-xylosyltransferase 
 CG No CG32300  Old CG No CG17772 
 Synonyms CG17771, CG17772, anon-i2, CG32300, oxt, dOXT 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ueyama M, Takemae H, Ohmae Y, Yoshida H, Toyoda H, Ueda R, Nishihara S.
Functional analysis of proteoglycan galactosyltransferase II RNA interference mutant flies.
J. Biol. Chem. (2008) 283(10) 6076-84 [ PubMed ID = 18165227 ] [ RRC reference ]

Goda E, Kamiyama S, Uno T, Yoshida H, Ueyama M, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S.
Identification and characterization of a novel Drosophila 3'-phosphoadenosine 5'-phosphosulfate transporter.
J. Biol. Chem. (2006) 281(39) 28508-17 [ PubMed ID = 16873373 ] [ RRC reference ]

Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGACCCTCGACAAGTTGGTGGATTTCTTGAGCGCCAATCCTGGCAGGAACTTTGTTAAGG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCCACGGCCGGGAGACACAGAAGTTCATCCAGAAGCAGGGCTTGGACAAGACGTTCGTCG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGTGCGACACGCACATGTGGAGAATAGGAGATCGGAAGTTGCCAGCTGGCATTCAAGTGG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACGGAGGCAGTGACTGGGTGGCGCTATCACGACCTTTTGTGGGCTATGTTACTCATCCCA 240

                           ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     241 GGGAAGACGATGAGTTGTTGCAGGCTCTTCTAAAGCTCTTCCGACACACGCTCCTGCCGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGGAATCGTTTTTCCACACGGTCCTCAGGAATACCAAGCATTGCACGAGCTATGTGGACA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACAACCTGCACGTCACCAACTGGAAGCGGAAGCAGGGTTGCAAATGCCAGTACAAGCATG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGGTGGATTGGTGCGGATGCAGTCCAAACGACTTTAAGCCAGAAGATTGGCCCAGGCTGC 480

17772R-1.IR full       481 AGGCCACGGAGCAGAAATCA 500
                           |||||||||||||||||||| silico     481 AGGCCACGGAGCAGAAATCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_139448.2  peptide O-xylosyltransferase CG32300-RB (oxt), mRNA 
NM_169703.1  Myosin heavy chain-like CG31045-RD, transcript variant D (Mhcl), mRNA 
NM_169701.2  Myosin heavy chain-like CG31045-RB, transcript variant B (Mhcl), mRNA 
NM_170650.3  Myosin heavy chain-like CG31045-RC, transcript variant C (Mhcl), mRNA 
NM_001043251.1  Myosin heavy chain-like CG31045-RF, transcript variant F (Mhcl), mRNA 
NM_001043250.1  Myosin heavy chain-like CG31045-RG, transcript variant G (Mhcl), mRNA 
NM_169700.2  Myosin heavy chain-like CG31045-RA, transcript variant A (Mhcl), mRNA 
NM_080250.2  diablo CG6224-RA (dbo), mRNA 
NM_001032002.1  CG33676-RA, transcript variant A (Skeletor), mRNA 
NM_001032000.1  CG14681-RB, transcript variant B (CG14681), mRNA 
NM_135768.2  CG16972-RA (CG16972), mRNA 
NM_176553.1  CG6129-RC, transcript variant C (CG6129), mRNA 
NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
NM_136864.2  CG13185-RA (CG13185), mRNA 
NM_170301.1  CG14253-RC, transcript variant C (CG14253), mRNA 
NM_170303.1  CG14253-RE, transcript variant E (CG14253), mRNA 
NM_170302.1  CG14253-RD, transcript variant D (CG14253), mRNA 
NM_170536.2  discs overgrown CG2048-RB, transcript variant B (dco), mRNA 
NM_170535.1  discs overgrown CG2048-RA, transcript variant A (dco), mRNA 
NM_079863.2  discs overgrown CG2048-RC, transcript variant C (dco), mRNA 
NM_132831.1  CG8184-RB (CG8184), mRNA 
NM_057865.3  cGMP-dependent protein kinase 21D CG3324-RA (Pkg21D), mRNA 
NM_142686.1  CG17282-RA (CG17282), mRNA 
NM_078773.2  adenosine 3 CG31628-RA, transcript variant A (ade3), mRNA 
NM_166213.2  fat-spondin CG6953-RB, transcript variant B (fat-spondin), mRNA 
NM_058087.4  fat-spondin CG6953-RA, transcript variant A (fat-spondin), mRNA 
NM_140248.1  Tim13 CG11611-RA (Tim13), mRNA 
NM_135306.2  CG7144-RA (CG7144), mRNA 
NM_001032069.1  Nitric oxide synthase CG6713-RF, transcript variant F (Nos), mRNA 
NM_001032075.1  Nitric oxide synthase CG6713-RI, transcript variant I (Nos), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.