National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17703R-1 
 Symbol dlp  Full Name dally-like 
 CG No CG32146  Old CG No CG17703 
 Synonyms CG32146, Dlp, dly, Dly, Dally-like, D-gpcB, CT16138, CG5031, CG17703, dlp 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||| |  ||||||| ||||||||||||||||||||||||||||||||| silico     1   ACAACATCTGCATTGCAGAAGAAAAGCTACAGCAACAACAACTGCCCGCCTTGTGATATT 60

                           |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| silico     61  CAGCAGTCCTCTTCTACTATTACTACTCACCACCCACTTGCCGCCCACCTTACAAGCGGA 120

                           |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAATGGCCCCGCCCCCCAAGTGGCCGCCCTTGCCGCCCCCAATCCGGCGGGTGGCGTAGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGGGTCTTCGATCATCGATCAATTCAGTCCGAATTGCAGTGCTGTGACACACATTTTCCA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCGAGAGGAATCGATGCCATCGAAATTCCCCAAAAACCCAGTAACGAACGAGTCCTACG 300

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     301 ATATTGCGAGTCCCCTTCGGTGGGCACTTGTTGCACCTACAACATGGAGACCCGCATGGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATGCAATCCCGCCAGCAGCTCGAAGGGCACACCAAGGACCAGATCTCTCGTATGTCTGG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AATCCTGGGCAGCAAGGCCACAAAATTCAAAGATATTTTCACGGCCCTGCTCAAAGAGTC 480

17703R-1.IR full       481 GCGAACGCAGTTCAATAGTA 500
                           |||||||||||||||||||| silico     481 GCGAACGCAGTTCAATAGTA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_206353.1  dally-like CG32146-RB, transcript variant B (dlp), mRNA 
100  482  NM_079347.2  dally-like CG32146-RA, transcript variant A (dlp), mRNA 
0.41  NM_167639.1  CG7453-RB, transcript variant B (CG7453), mRNA 
0.41  NM_133127.1  CG7453-RA, transcript variant A (CG7453), mRNA 
0.2  NM_169693.1  Helicase 89B CG4261-RA (Hel89B), mRNA 
18  51  NM_167343.1  CG32642-RC (CG32642), mRNA 
NM_176103.1  CG14764-RA (CG14764), mRNA 
NM_165742.1  14-3-3zeta CG17870-RB, transcript variant B (14-3-3zeta), mRNA 
NM_165740.2  14-3-3zeta CG17870-RE, transcript variant E (14-3-3zeta), mRNA 
NM_206070.1  14-3-3zeta CG17870-RH, transcript variant H (14-3-3zeta), mRNA 
NM_165741.2  14-3-3zeta CG17870-RA, transcript variant A (14-3-3zeta), mRNA 
NM_001014515.1  14-3-3zeta CG17870-RJ, transcript variant J (14-3-3zeta), mRNA 
NM_165743.2  14-3-3zeta CG17870-RC, transcript variant C (14-3-3zeta), mRNA 
NM_057537.3  14-3-3zeta CG17870-RD, transcript variant D (14-3-3zeta), mRNA 
NM_165745.2  14-3-3zeta CG17870-RG, transcript variant G (14-3-3zeta), mRNA 
NM_165744.2  14-3-3zeta CG17870-RF, transcript variant F (14-3-3zeta), mRNA 
NM_057839.3  kuzbanian CG7147-RA, transcript variant A (kuz), mRNA 
NM_165047.1  kuzbanian CG7147-RB, transcript variant B (kuz), mRNA 
NM_078500.3  Multiple inositol polyphosphate phosphatase 2 CG4317-RA (Mipp2), mRNA 
10  NM_176408.1  CG33097-RA, transcript variant A (CG33097), mRNA 
10  NM_001043218.1  CG33097-RB, transcript variant B (CG33097), mRNA 
13  NM_080025.1  cut CG11387-RA, transcript variant A (ct), mRNA 
NM_132187.2  Nek2 CG17256-RA (Nek2), mRNA 
27  NM_132041.2  CG15765-RA (CG15765), mRNA 
21  NM_132042.1  CG11462-RA (CG11462), mRNA 
NM_001032110.1  spitz CG10334-RG, transcript variant G (spi), mRNA 
NM_134291.3  spitz CG10334-RA, transcript variant A (spi), mRNA 
NM_134293.2  spitz CG10334-RB, transcript variant B (spi), mRNA 
NM_134295.1  spitz CG10334-RD, transcript variant D (spi), mRNA 
NM_134294.1  spitz CG10334-RC, transcript variant C (spi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.