National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1765R-4 
 Symbol EcR  Full Name Ecdysone receptor 
 CG No CG1765  Old CG No CG1765 
 Synonyms Ecr, EcRB1, EcR-B1, ecr, DmEcR, EcRB-1, CG1765, EcR-A, NR1H1, DEcR, snt, ECR, dECR, lie, EcdR, CG8347, ms(2)42A, ms(2)06410, Dhr23, anon-WO0229075.1, EcR, EcR-B 
 Accession No (Link to NCBI) NM_165465.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Gancz D, Gilboa L.
Insulin and Target of rapamycin signaling orchestrate the development of ovarian niche-stem cell units in Drosophila.
Development (2013) 140(20) 4145-54 [ PubMed ID = 24026119 ] [ RRC reference ]

Denton D, Xu T, Dayan S, Nicolson S, Kumar S.
Dpp regulates autophagy-dependent midgut removal and signals to block ecdysone production.
Cell Death Differ. (2018) [ PubMed ID = 29959404 ] [ RRC reference ]

Gancz D, Lengil T, Gilboa L.
Coordinated regulation of niche and stem cell precursors by hormonal signaling.
PLoS Biol. (2011) 9(11) e1001202 [ PubMed ID = 22131903 ] [ RRC reference ]

Sinenko SA, Hung T, Moroz T, Tran QM, Sidhu S, Cheney MD, Speck NA, Banerjee U.
Genetic manipulation of AML1-ETO-induced expansion of hematopoietic precursors in a Drosophila model.
Blood (2010) 116(22) 4612-20 [ PubMed ID = 20688956 ] [ RRC reference ]

Dourlen P, Fernandez-Gomez FJ, Dupont C, Grenier-Boley B, Bellenguez C, Obriot H, Caillierez R, Sottejeau Y, Chapuis J, Bretteville A, Abdelfettah F, Delay C, Malmanche N, Soininen H, Hiltunen M, Galas MC, Amouyel P, Sergeant N, Buée L, Lambert JC, Dermaut B.
Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology.
Mol. Psychiatry (2017) 22(6) 874-883 [ PubMed ID = 27113998 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| silico     1   CCGGGTGCCACTAATCTGGGAGCGTTGGCCAACGGGATGCTCAATGGGGGCTTCAATGGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGCAGCAACAGATTCAGAATGGCCACGGCCTCATCAACTCCACAACGCCCTCAACGCCG 120

                          ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     121 ACCACCCCGCTCCACCTTCAGCAGAACCTGGGGGGCGCGGGCGGCGGCGGT-ATCGGGGG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AATGGGTATTCTTCACCACGCGAATGGCACCCCAAATGGCCTTATCGGAGTTGTGGGAGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGGCGGCGGAGTAGGTCTTGGAGTAGGCGGAGGCGGAGTGGGAGGCCTGGGAATGCAGCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CACACCCCGAAGCGATTCGGTGAATTCTATATCTTCAGGTCGCGATGATCTCTCGCCTTC 360

                          |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     361 GAGCAGCTTGAACGGATACTCGGCGAACGAAAGCTGCGATGCGAAGAAGAGCAAGAAGGG 420

                          ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| silico     421 ACCTGCGCCACGGGTGCAAGAGGAGCTGTGCCTGGTTTGCGGCGA-CAGGGCCTCCGGCT 480

1765R-4.IR_full       481 ACCACTANAANGC 493
                          ||||||| || || silico     481 ACCACTACAACGC 493

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   473  NM_165465.1  CG1765-RB, transcript variant B (EcR), mRNA 
29.38   139  NM_165461.1  CG1765-RA, transcript variant A (EcR), mRNA 
29.38   139  NM_165463.1  CG1765-RE, transcript variant E (EcR), mRNA 
29.38   139  NM_165462.1  CG1765-RD, transcript variant D (EcR), mRNA 
28.96   137  NM_165464.1  CG1765-RC, transcript variant C (EcR), mRNA 
0.21   NM_166480.1  CG17950-RB, transcript variant B (HmgD), mRNA 
0.21   NM_166479.1  CG17950-RA, transcript variant A (HmgD), mRNA 
0   16  28  NM_167394.1  CG32603-RA (CG32603), mRNA 
0   11  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   11  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_141965.1  CG14395-RA (CG14395), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   10  NM_079747.2  CG5394-RA, transcript variant A (Aats-glupro), mRNA 
0   NM_170103.1  CG5394-RB, transcript variant B (Aats-glupro), mRNA 
0   11  NM_079818.2  CG10002-RA (fkh), mRNA 
0   11  NM_166498.1  CG13499-RC, transcript variant C (CG13499), mRNA 
0   11  NM_166497.1  CG13499-RA, transcript variant A (CG13499), mRNA 
0   11  NM_166499.1  CG13499-RD, transcript variant D (CG13499), mRNA 
0   11  NM_137784.1  CG13499-RB, transcript variant B (CG13499), mRNA 
0   NM_001042810.1  CG10952-RB, transcript variant B (eag), mRNA 
0   NM_078603.2  CG10952-RA, transcript variant A (eag), mRNA 
0   NM_078725.2  CG4276-RD, transcript variant D (aru), mRNA 
0   NM_164395.1  CG4276-RC, transcript variant C (aru), mRNA 
0   NM_164393.1  CG4276-RA, transcript variant A (aru), mRNA 
0   NM_141104.1  CG14564-RA (CG14564), mRNA 
0   NM_134550.1  CG1695-RA, transcript variant A (CG1695), mRNA 
0   21  38  NM_137950.1  CG9815-RA (CG9815), mRNA 
0   16  NM_143056.1  CG17462-RA (CG17462), mRNA 
0   11  NM_078689.2  CG14228-RA (Mer), mRNA 
0   NM_137194.1  CG8179-RA (CG8179), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.