National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1762R-1 
 Symbol betaInt-nu  Full Name beta[nu] integrin 
 CG No CG1762  Old CG No CG1762 
 Synonyms betanu, betav, CG1762, CT5192, beta[[v]], Beta[[nu]], betaInt[nu], betaInt-nu, beta[nu]-integrin 
 Accession No (Link to NCBI) NM_078884.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nonaka S, Ando Y, Kanetani T, Hoshi C, Nakai Y, Nainu F, Nagaosa K, Shiratsuchi A, Nakanishi Y.
Signaling pathway for phagocyte priming upon encounter with apoptotic cells.
J. Biol. Chem. (2017) 292(19) 8059-8072 [ PubMed ID = 28325838 ] [ RRC reference ]

Nonaka S, Hori A, Nakanishi Y, Kuraishi T.
Phagocytosis Assay for Apoptotic Cells in Drosophila Embryos.
J Vis Exp (2017) (126) [ PubMed ID = 28809832 ] [ RRC reference ]

Kim MJ, Choe KM.
Basement membrane and cell integrity of self-tissues in maintaining Drosophila immunological tolerance.
PLoS Genet. (2014) 10(10) e1004683 [ PubMed ID = 25329560 ] [ RRC reference ]

Nonaka S, Nagaosa K, Mori T, Shiratsuchi A, Nakanishi Y.
Integrin αPS3/βν-mediated phagocytosis of apoptotic cells and bacteria in Drosophila.
J. Biol. Chem. (2013) 288(15) 10374-80 [ PubMed ID = 23426364 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAATACCAGGTGGGATATCG 
 Primer Seq. 3'
aatctagaggtaccCTGGTATATCATCGGTTAGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAATACCAG GTGGGATATC GTTGTCTCTC TCGCCGGCAA CTACTTAACT ACAACTGCAG 
0061 TGAAACGTGA TATATACGAG AACCAGCCGG TCCTAGATGT CCTTCAGGAT AAGCCCCTAA 
0121 AGGACTACGA AACCAGTGAT CAGGCTGTCC AAGTCACACC CCAGCGGGCA TACCTTAAGT 
0181 TGGTCAAAGG AAACAAGCAA AGAATGAAGC TGAGCTATAG AACTGCACGC AACAATCCAC 
0241 TCGATTTGTA CGTATTGATG GATCTAACCT GGACAATGAG GGATGACAAG AAAACCCTGG 
0301 AGGAGTTGGG AGCCCAACTC AGTCAGACTC TTAAAAATCT AACAGGAAAC TACAGATTGG 
0361 GATTTGGTTC TTTCGCGGAC AAGCCAACTC TACCCATGAT TCTGCCACAG CATAGGGAAA 
0421 ACCCCTGTGC TGCGGAGCGG GCCACGTGTG AACCAACCTA TGGATATAGA CATCAACTTT 
0481 CGCTAACCGA TGATATACCA G 
 in silico PCR Fragment
0001 GGAATACCAG GTGGGATATC GTTGTCTCTC TCGCCGGCAA CTACTTAACT ACAACTGCAG 
0061 TGAAACG-GA TATATACGAG AACCAGCCGG TCCTAGATGT CCTTCAGGAT AAGCCCCTAA 
0121 AGGACTACGA AACCAGTGAT CAGGCTGTCC AAGTCACACC CCAGCGGGCA TACCTTAAGT 
0181 TGGTCAAAGG AAACACGCAA AGAATGAAGC TGAGCTATAG AACTGCACGC AACAATCCAC 
0241 TCGATTTGTA CGTATTGATG GATCTAACCT GGACAATGAG GGATGACAAG AAAACCCTGG 
0301 AGGAGTTGGG AGCCCAACTC AGTCAGACTC TTAAAAATCT AACAGGAAAC TACAGATTGG 
0361 GATTTGGTTC TTTCGCGGAC AAGCCAACTC TACCCATGAT TCTGCCACAG CATAGGGAAA 
0421 ACCCCTGTGC TGCGGAGCGG GCCACGTGTG AACCAACCTA TGGATATAGA CATCAACTTT 
0481 CGCTAACCGA TGATATACCA G 
 Assemble Data

1762R-1.IR_full       1   GGAATACCAGGTGGGATATCGTTGTCTCTCTCGCCGGCAACTACTTAACTACAACTGCAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1762R-1.in silico     1   GGAATACCAGGTGGGATATCGTTGTCTCTCTCGCCGGCAACTACTTAACTACAACTGCAG 60


1762R-1.IR_full       61  TGAAACGTGATATATACGAGAACCAGCCGGTCCTAGATGTCCTTCAGGATAAGCCCCTAA 120
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
1762R-1.in silico     61  TGAAACG-GATATATACGAGAACCAGCCGGTCCTAGATGTCCTTCAGGATAAGCCCCTAA 120


1762R-1.IR_full       121 AGGACTACGAAACCAGTGATCAGGCTGTCCAAGTCACACCCCAGCGGGCATACCTTAAGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1762R-1.in silico     121 AGGACTACGAAACCAGTGATCAGGCTGTCCAAGTCACACCCCAGCGGGCATACCTTAAGT 180


1762R-1.IR_full       181 TGGTCAAAGGAAACAAGCAAAGAATGAAGCTGAGCTATAGAACTGCACGCAACAATCCAC 240
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
1762R-1.in silico     181 TGGTCAAAGGAAACACGCAAAGAATGAAGCTGAGCTATAGAACTGCACGCAACAATCCAC 240


1762R-1.IR_full       241 TCGATTTGTACGTATTGATGGATCTAACCTGGACAATGAGGGATGACAAGAAAACCCTGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1762R-1.in silico     241 TCGATTTGTACGTATTGATGGATCTAACCTGGACAATGAGGGATGACAAGAAAACCCTGG 300


1762R-1.IR_full       301 AGGAGTTGGGAGCCCAACTCAGTCAGACTCTTAAAAATCTAACAGGAAACTACAGATTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1762R-1.in silico     301 AGGAGTTGGGAGCCCAACTCAGTCAGACTCTTAAAAATCTAACAGGAAACTACAGATTGG 360


1762R-1.IR_full       361 GATTTGGTTCTTTCGCGGACAAGCCAACTCTACCCATGATTCTGCCACAGCATAGGGAAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1762R-1.in silico     361 GATTTGGTTCTTTCGCGGACAAGCCAACTCTACCCATGATTCTGCCACAGCATAGGGAAA 420


1762R-1.IR_full       421 ACCCCTGTGCTGCGGAGCGGGCCACGTGTGAACCAACCTATGGATATAGACATCAACTTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1762R-1.in silico     421 ACCCCTGTGCTGCGGAGCGGGCCACGTGTGAACCAACCTATGGATATAGACATCAACTTT 480


1762R-1.IR_full       481 CGCTAACCGATGATATACCAG 501
                          |||||||||||||||||||||
1762R-1.in silico     481 CGCTAACCGATGATATACCAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078884.2  CG1762-RA (betaInt-nu), mRNA 
0   NM_143112.1  CG11878-RA (CG11878), mRNA 
0   NM_165198.1  CG31810-RA (CG31810), mRNA 
0   NM_135472.4  CG4128-RC, transcript variant C (nAcRalpha-30D), mRNA 
0   NM_205951.1  CG4128-RB, transcript variant B (nAcRalpha-30D), mRNA 
0   NM_164874.2  CG4128-RA, transcript variant A (nAcRalpha-30D), mRNA 
0   NM_205953.1  CG4128-RE, transcript variant E (nAcRalpha-30D), mRNA 
0   NM_205952.1  CG4128-RD, transcript variant D (nAcRalpha-30D), mRNA 
0   NM_001038799.1  CG4128-RF, transcript variant F (nAcRalpha-30D), mRNA 
0   NM_142183.1  CG4334-RA (CG4334), mRNA 
0   NM_144367.1  CG6633-RA (Ugt86Dd), mRNA 
0   NM_137081.2  CG30483-RA (Prosap), mRNA 
0   NM_137140.2  CG10151-RC, transcript variant C (CG10151), mRNA 
0   NM_166068.1  CG10151-RB, transcript variant B (CG10151), mRNA 
0   NM_166067.1  CG10151-RA, transcript variant A (CG10151), mRNA 
0   NM_176542.1  CG7029-RA (CG7029), mRNA 
0   NM_134751.1  CG5556-RA (CG5556), mRNA 
0   11  NM_001031986.1  CG33719-RB, transcript variant B (Pif1A), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_132990.2  CG8557-RA, transcript variant A (CG8557), mRNA 
0   NM_176751.1  CG8557-RB, transcript variant B (CG8557), mRNA 
0   NM_134731.2  CG4764-RA (CG4764), mRNA 
0   NM_139513.2  CG7740-RC, transcript variant C (prominin-like), mRNA 
0   NM_132395.1  CG2898-RA (CG2898), mRNA 
0   NM_167986.1  CG7740-RA, transcript variant A (prominin-like), mRNA 
0   NM_141170.2  CG11115-RA (Ssl1), mRNA 
0   NM_206021.1  CG1374-RB, transcript variant B (tsh), mRNA 
0   NM_167987.1  CG7740-RB, transcript variant B (prominin-like), mRNA 
0   NM_176504.1  CG33207-RB, transcript variant B (pxb), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
+- 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.