National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17520R-2 
 Symbol CkIIalpha  Full Name Casein kinase II alpha subunit 
 CG No CG17520  Old CG No CG17520 
 Synonyms CK2alpha, CKII, CK2, DmCK2alpha, CKIIalfa, CKIIalpha, dCKII, CK2a, DmCKIIalpha, CK-II, CKII-alpha, Tik, CKIIa, CG17520, CK II, CK2 alpha, CkII, CK-II alpha, CK-2, CkIIalpha, Cask-II-a, anon-WO02059370.53, Casein kinase II, casein kinase 2, dCK2alpha 
 Accession No (Link to NCBI) NM_168985.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Hu L, Huang H, Li J, Yin MX, Lu Y, Wu W, Zeng R, Jiang J, Zhao Y, Zhang L.
Drosophila casein kinase 2 (CK2) promotes warts protein to suppress Yorkie protein activity for growth control.
J. Biol. Chem. (2014) 289(48) 33598-607 [ PubMed ID = 25320084 ] [ RRC reference ]

Szabó A, Papin C, Zorn D, Ponien P, Weber F, Raabe T, Rouyer F.
The CK2 kinase stabilizes CLOCK and represses its activity in the Drosophila circadian oscillator.
PLoS Biol. (2013) 11(8) e1001645 [ PubMed ID = 24013921 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGATGTCAATGCGCACAAAC 
 Primer Seq. 3'
aatctagaggtaccGGCAAGTCCCCAATCTATAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGATGTCAA TGCGCACAAA CCGGATGAAT ATTGGGACTA TGAAAATTAT GTGGTTGATT 
0061 GGGGCAATCA AGACGATTAT CAGTTGGTCC GTAAATTAGG CCGTGGAAAG TATTCTGAGG 
0121 TCTTCGAGGC CATTAATATT ACGACCACGG AAAAGTGCGT TGTTAAAATT CTGAAACCTG 
0181 TTAAAAAAAA GAAGATAAAG CGTGAAATCA AAATTTTGGA GAACTTGCGT GGAGGAACTA 
0241 ATATAATAAC ACTTTTAGCC GTTGTCAAGG ACCCAGTTTC TCGAACACCA GCGTTGATTT 
0301 TTGAGCACGT CAACAACACA GATTTCAAGC AACTTTACCA AACATTAACT GATTATGAGA 
0361 TTCGTTACTA CTTGTTTGAG CTTCTTAAGG CACTTGACTA CTGCCACAGC ATGGGNAATA 
0421 ATGCATCGTG ATGTAAAGCC CCACAATGTT ATGATAGATC ACGAAAATCG AAAATTGCGC 
0481 CTTATAGATT GGGGAcTTNC c 
 in silico PCR Fragment
0001 CAGATGTCAA TGCGCACAAA CCGGATGAAT ATTGGGACTA TGAAAATTAT GTGGTTGATT 
0061 GGGGCAATCA AGACGATTAT CAGTTGGTCC GTAAATTAGG CCGTGGAAAG TATTCTGAGG 
0121 TCTTCGAGGC CATTAATATT ACGACCACGG AAAAGTGCGT TGTTAAAATT CTGAAACCTG 
0181 TTAAAAAAAA GAAGATAAAG CGTGAAATCA AAATTTTGGA GAACTTGCGT GGAGGAACTA 
0241 ATATAATAAC ACTTTTAGCC GTTGTCAAGG ACCCAGTTTC TCGAACACCA GCGTTGATTT 
0301 TTGAGCACGT CAACAACACA GATTTCAAGC AACTTTACCA AACATTAACT GATTATGAGA 
0361 TTCGTTACTA CTTGTTTGAG CTTCTTAAGG CACTTGACTA CTGCCACAGC ATGGG-AATA 
0421 ATGCATCGTG ATGTAAAGCC CCACAATGTT ATGATAGATC ACGAAAATCG AAAATTGCGC 
0481 CTTATAGATT GGGGACTTGC C 
 Assemble Data

17520R-2.IR_full       1   CAGATGTCAATGCGCACAAACCGGATGAATATTGGGACTATGAAAATTATGTGGTTGATT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17520R-2.in silico     1   CAGATGTCAATGCGCACAAACCGGATGAATATTGGGACTATGAAAATTATGTGGTTGATT 60


17520R-2.IR_full       61  GGGGCAATCAAGACGATTATCAGTTGGTCCGTAAATTAGGCCGTGGAAAGTATTCTGAGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17520R-2.in silico     61  GGGGCAATCAAGACGATTATCAGTTGGTCCGTAAATTAGGCCGTGGAAAGTATTCTGAGG 120


17520R-2.IR_full       121 TCTTCGAGGCCATTAATATTACGACCACGGAAAAGTGCGTTGTTAAAATTCTGAAACCTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17520R-2.in silico     121 TCTTCGAGGCCATTAATATTACGACCACGGAAAAGTGCGTTGTTAAAATTCTGAAACCTG 180


17520R-2.IR_full       181 TTAAAAAAAAGAAGATAAAGCGTGAAATCAAAATTTTGGAGAACTTGCGTGGAGGAACTA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17520R-2.in silico     181 TTAAAAAAAAGAAGATAAAGCGTGAAATCAAAATTTTGGAGAACTTGCGTGGAGGAACTA 240


17520R-2.IR_full       241 ATATAATAACACTTTTAGCCGTTGTCAAGGACCCAGTTTCTCGAACACCAGCGTTGATTT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17520R-2.in silico     241 ATATAATAACACTTTTAGCCGTTGTCAAGGACCCAGTTTCTCGAACACCAGCGTTGATTT 300


17520R-2.IR_full       301 TTGAGCACGTCAACAACACAGATTTCAAGCAACTTTACCAAACATTAACTGATTATGAGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17520R-2.in silico     301 TTGAGCACGTCAACAACACAGATTTCAAGCAACTTTACCAAACATTAACTGATTATGAGA 360


17520R-2.IR_full       361 TTCGTTACTACTTGTTTGAGCTTCTTAAGGCACTTGACTACTGCCACAGCATGGGNAATA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
17520R-2.in silico     361 TTCGTTACTACTTGTTTGAGCTTCTTAAGGCACTTGACTACTGCCACAGCATGGG-AATA 420


17520R-2.IR_full       421 ATGCATCGTGATGTAAAGCCCCACAATGTTATGATAGATCACGAAAATCGAAAATTGCGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17520R-2.in silico     421 ATGCATCGTGATGTAAAGCCCCACAATGTTATGATAGATCACGAAAATCGAAAATTGCGC 480


17520R-2.IR_full       481 CTTATAGATTGGGGACTTNCC 501
                           |||||||||||||||||| ||
17520R-2.in silico     481 CTTATAGATTGGGGACTTGCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001043159.1  CG17520-RD, transcript variant D (CkIIalpha), mRNA 
100   482  NM_168985.1  CG17520-RA, transcript variant A (CkIIalpha), mRNA 
100   482  NM_168986.1  CG17520-RC, transcript variant C (CkIIalpha), mRNA 
100   482  NM_080179.4  CG17520-RB, transcript variant B (CkIIalpha), mRNA 
0   NM_164364.2  CG4822-RB, transcript variant B (CG4822), mRNA 
0   NM_168683.1  CG9705-RB, transcript variant B (CG9705), mRNA 
0   NM_140663.2  CG9705-RA, transcript variant A (CG9705), mRNA 
0   NM_001042832.1  CG41476-RA (CG41476), mRNA 
0   NM_001042998.1  CG17528-RC, transcript variant C (CG17528), mRNA 
0   NM_001042997.1  CG17528-RD, transcript variant D (CG17528), mRNA 
0   NM_001042996.1  CG17528-RB, transcript variant B (CG17528), mRNA 
0   NM_001042999.1  CG17528-RA, transcript variant A (CG17528), mRNA 
0   NM_080096.2  CG7869-RA (SuUR), mRNA 
0   NM_142241.1  CG4560-RB, transcript variant B (Arpc3A), mRNA 
0   NM_169675.1  CG4560-RA, transcript variant A (Arpc3A), mRNA 
0   NM_144346.2  CG6264-RA (Best1), mRNA 
0   NM_132995.1  CG12991-RA, transcript variant A (CG12991), mRNA 
0   NM_167571.1  CG12991-RB, transcript variant B (CG12991), mRNA 
0   NM_136689.1  CG30007-RB, transcript variant B (CG30007), mRNA 
0   NM_165719.1  CG30007-RA, transcript variant A (CG30007), mRNA 
0   NM_078491.2  CG4193-RA (dhd), mRNA 
0   85  323  NM_168226.1  CG32377-RA (CG32377), mRNA 
0   NM_168504.1  CG32111-RA (CG32111), mRNA 
0   NM_001031890.1  CG14425-RA, transcript variant A (CG14425), mRNA 
0   NM_001031891.1  CG18350-RO, transcript variant O (Sxl), mRNA 
0   NM_001031893.1  CG18350-RM, transcript variant M (Sxl), mRNA 
0   NM_167114.2  CG18350-RH, transcript variant H (Sxl), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 
0   NM_166489.2  CG13491-RA (Gr58c), mRNA 
0   NM_057597.2  CG10719-RA, transcript variant A (brat), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.