National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17520R-1 
 Symbol CkIIalpha  Full Name Casein kinase II alpha subunit 
 CG No CG17520  Old CG No CG17520 
 Synonyms CK2alpha, CKII, CK2, DmCK2alpha, CKIIalfa, CKIIalpha, dCKII, CK2a, DmCKIIalpha, CK-II, CKII-alpha, Tik, CKIIa, CG17520, CK II, CK2 alpha, CkII, CK-II alpha, CK-2, CkIIalpha, Cask-II-a, anon-WO02059370.53, Casein kinase II, casein kinase 2, dCK2alpha 
 Accession No (Link to NCBI) NM_168985.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Hu L, Huang H, Li J, Yin MX, Lu Y, Wu W, Zeng R, Jiang J, Zhao Y, Zhang L.
Drosophila casein kinase 2 (CK2) promotes warts protein to suppress Yorkie protein activity for growth control.
J. Biol. Chem. (2014) 289(48) 33598-607 [ PubMed ID = 25320084 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CAGATGTCAATGCGCACAAACCGGATGAATATTGGGACTATGAAAATTATGTGGTTGATT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGGGCAATCAAGACGATTATCAGTTGGTCCGTAAATTAGGCCGTGGAAAGTATTCTGAGG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCTTCGAGGCCATTAATATTACGACCACGGAAAAGTGCGTTGTTAAAATTCTGAAACCTG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTAAAAAAAAGAAGATAAAGCGTGAAATCAAAATTTTGGAGAACTTGCGTGGAGGAACTA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATATAATAACACTTTTAGCCGTTGTCAAGGACCCAGTTTCTCGAACACCAGCGTTGATTT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTGAGCACGTCAACAACACAGATTTCAAGCAACTTTACCAAACATTAACTGATTATGAGA 360

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     361 TTCGTTACTACTTGTTTGAGCTTCTTAAGGCACTTGACTACTGCCACAGCATGGG-AATA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATGCATCGTGATGTAAAGCCCCACAATGTTATGATAGATCACGAAAATCGAAAATTGCGC 480

17520R-1.IR_full       481 CTTATAGATTGGGGACTTNCC 501
                           |||||||||||||||||| || silico     481 CTTATAGATTGGGGACTTGCC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001043159.1  CG17520-RD, transcript variant D (CkIIalpha), mRNA 
100   482  NM_168985.1  CG17520-RA, transcript variant A (CkIIalpha), mRNA 
100   482  NM_168986.1  CG17520-RC, transcript variant C (CkIIalpha), mRNA 
100   482  NM_080179.4  CG17520-RB, transcript variant B (CkIIalpha), mRNA 
0   NM_164364.2  CG4822-RB, transcript variant B (CG4822), mRNA 
0   NM_168683.1  CG9705-RB, transcript variant B (CG9705), mRNA 
0   NM_140663.2  CG9705-RA, transcript variant A (CG9705), mRNA 
0   NM_001042832.1  CG41476-RA (CG41476), mRNA 
0   NM_001042998.1  CG17528-RC, transcript variant C (CG17528), mRNA 
0   NM_001042997.1  CG17528-RD, transcript variant D (CG17528), mRNA 
0   NM_001042996.1  CG17528-RB, transcript variant B (CG17528), mRNA 
0   NM_001042999.1  CG17528-RA, transcript variant A (CG17528), mRNA 
0   NM_080096.2  CG7869-RA (SuUR), mRNA 
0   NM_142241.1  CG4560-RB, transcript variant B (Arpc3A), mRNA 
0   NM_169675.1  CG4560-RA, transcript variant A (Arpc3A), mRNA 
0   NM_144346.2  CG6264-RA (Best1), mRNA 
0   NM_132995.1  CG12991-RA, transcript variant A (CG12991), mRNA 
0   NM_167571.1  CG12991-RB, transcript variant B (CG12991), mRNA 
0   NM_136689.1  CG30007-RB, transcript variant B (CG30007), mRNA 
0   NM_165719.1  CG30007-RA, transcript variant A (CG30007), mRNA 
0   NM_078491.2  CG4193-RA (dhd), mRNA 
0   85  323  NM_168226.1  CG32377-RA (CG32377), mRNA 
0   NM_168504.1  CG32111-RA (CG32111), mRNA 
0   NM_001031890.1  CG14425-RA, transcript variant A (CG14425), mRNA 
0   NM_001031891.1  CG18350-RO, transcript variant O (Sxl), mRNA 
0   NM_001031893.1  CG18350-RM, transcript variant M (Sxl), mRNA 
0   NM_167114.2  CG18350-RH, transcript variant H (Sxl), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 
0   NM_166489.2  CG13491-RA (Gr58c), mRNA 
0   NM_057597.2  CG10719-RA, transcript variant A (brat), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.