National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17299R-1 
 Symbol SNF4Agamma  Full Name SNF4/AMP-activated protein kinase gamma subunit 
 CG No CG17299  Old CG No CG17299 
 Synonyms SNF4Ag, SNF4A, loe, FBgn0025803, SNF4a, CG17299, EP3015b, SNF4, CG5806, anon-WO0257455.21, anon-WO0118547.575, anon-WO0118547.338, SNF4Agamma, SNF4/AMP-activated protein kinase gamma subunit, SNF4/AMP-activated protein kinase gamma, lochrig, loechrig 
 Accession No (Link to NCBI) NM_169946.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATGCAGAACTTTAGCCATCG 
 Primer Seq. 3'
aatctagaggtaccAGGTGGGTATCAGATCATAGC 
 Predicted Fragment Size
539 
 IR fragment full Seq
0001 CATGCAGAAC TTTAGCCATC GCCAGCATCC CGCCGTGACG ATAACGAGCG CCGACGGCAC 
0061 GCAATCAACG GCAAAGAGCA AGTACAAAGA CGGCAGTGCC CATCCGCATC AAGGCAGCGA 
0121 CGCGCAGTAT TACCACACGG TGACGGCGGT GCGTCCAAAC TCTTCCCAAC GGTCGCCGAT 
0181 GACCAAGGTC ATGGATCTGT TCCGGCATCG ATCCAGCTCG GTTGTCAGCG AAGCCGACAA 
0241 ACGCAAAGCG CGCGCGGCGG CGCATCAGCA ACAGTTGGCT GTGCAAAGTG CTCACATGCG 
0301 TCGTGCCTCC GCGGATTTGG AGAAACGTCG TGCATCAGTT GGTGCCGCAG GTCGAGGACT 
0361 GCGAGGGGAT GGTACTTTGG ATCCACACCA TGCAGCCATC CTCTTCAGAG ACTCACGAGG 
0421 GTTGCCTGTC GCTGATCCGT TCCTAGAGAA AGTAAATCTA TCAGATCTGG AAGAGGACGA 
0481 CTCACAGATC TTCGTGAAGT TCTTTCGTTT TCACAAGTGC TATGATCTGA TACCCACCT 
 in silico PCR Fragment
0001 CATGCAGAAC TTTAGCCATC GCCAGCATCC CGCCGTGACG ATAACGAGCG CCGACGGCAC 
0061 GCAATCAACG GCAAAGAGCA AGTACAAAGA CGGCAGTGCC CATCCGCATC AAGGCAGCGA 
0121 CGCGCAGTAT TACCACACGG TGACGGCGGT GCGTCCAAAC TCTTCCCAAC GGTCGCCGAT 
0181 GACCAAGGTC ATGGATCTGT TCCGGCATCG ATCCAGCTCG GTTGTCAGCG AAGCCGACAA 
0241 ACGCAAAGCG CGCGCGGCGG CGCATCAGCA ACAGTTGGCT GTGCAAAGTG CTCACATGCG 
0301 TCGTGCCTCC GCGGATTTGG AGAAACGTCG TGCATCAGTT GGTGCCGCAG GTCGAGGACT 
0361 GCGAGGGGAT GGTACTTTGG ATCCACACCA TGCAGCCATC CTCTTCAGAG ACTCACGAGG 
0421 GTTGCCTGTC GCTGATCCGT TCCTAGAGAA AGTAAATCTA TCAGATCTGG AAGAGGACGA 
0481 CTCACAGATC TTCGTGAAGT TCTTTCGTTT TCACAAGTGC TATGATCTGA TACCCACCT 
 Assemble Data

17299R-1.IR_full       1   CATGCAGAACTTTAGCCATCGCCAGCATCCCGCCGTGACGATAACGAGCGCCGACGGCAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17299R-1.in silico     1   CATGCAGAACTTTAGCCATCGCCAGCATCCCGCCGTGACGATAACGAGCGCCGACGGCAC 60


17299R-1.IR_full       61  GCAATCAACGGCAAAGAGCAAGTACAAAGACGGCAGTGCCCATCCGCATCAAGGCAGCGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17299R-1.in silico     61  GCAATCAACGGCAAAGAGCAAGTACAAAGACGGCAGTGCCCATCCGCATCAAGGCAGCGA 120


17299R-1.IR_full       121 CGCGCAGTATTACCACACGGTGACGGCGGTGCGTCCAAACTCTTCCCAACGGTCGCCGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17299R-1.in silico     121 CGCGCAGTATTACCACACGGTGACGGCGGTGCGTCCAAACTCTTCCCAACGGTCGCCGAT 180


17299R-1.IR_full       181 GACCAAGGTCATGGATCTGTTCCGGCATCGATCCAGCTCGGTTGTCAGCGAAGCCGACAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17299R-1.in silico     181 GACCAAGGTCATGGATCTGTTCCGGCATCGATCCAGCTCGGTTGTCAGCGAAGCCGACAA 240


17299R-1.IR_full       241 ACGCAAAGCGCGCGCGGCGGCGCATCAGCAACAGTTGGCTGTGCAAAGTGCTCACATGCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17299R-1.in silico     241 ACGCAAAGCGCGCGCGGCGGCGCATCAGCAACAGTTGGCTGTGCAAAGTGCTCACATGCG 300


17299R-1.IR_full       301 TCGTGCCTCCGCGGATTTGGAGAAACGTCGTGCATCAGTTGGTGCCGCAGGTCGAGGACT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17299R-1.in silico     301 TCGTGCCTCCGCGGATTTGGAGAAACGTCGTGCATCAGTTGGTGCCGCAGGTCGAGGACT 360


17299R-1.IR_full       361 GCGAGGGGATGGTACTTTGGATCCACACCATGCAGCCATCCTCTTCAGAGACTCACGAGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17299R-1.in silico     361 GCGAGGGGATGGTACTTTGGATCCACACCATGCAGCCATCCTCTTCAGAGACTCACGAGG 420


17299R-1.IR_full       421 GTTGCCTGTCGCTGATCCGTTCCTAGAGAAAGTAAATCTATCAGATCTGGAAGAGGACGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17299R-1.in silico     421 GTTGCCTGTCGCTGATCCGTTCCTAGAGAAAGTAAATCTATCAGATCTGGAAGAGGACGA 480


17299R-1.IR_full       481 CTCACAGATCTTCGTGAAGTTCTTTCGTTTTCACAAGTGCTATGATCTGATACCCACCT 539
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17299R-1.in silico     481 CTCACAGATCTTCGTGAAGTTCTTTCGTTTTCACAAGTGCTATGATCTGATACCCACCT 539

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   521  NM_169946.1  CG17299-RA, transcript variant A (SNF4Agamma), mRNA 
100   521  NM_080509.2  CG17299-RB, transcript variant B (SNF4Agamma), mRNA 
100   521  NM_169947.1  CG17299-RF, transcript variant F (SNF4Agamma), mRNA 
44.91   234  NM_169948.1  CG17299-RC, transcript variant C (SNF4Agamma), mRNA 
44.91   234  NM_169949.1  CG17299-RE, transcript variant E (SNF4Agamma), mRNA 
44.91   234  NM_001043273.1  CG17299-RJ, transcript variant J (SNF4Agamma), mRNA 
44.91   234  NM_001043272.1  CG17299-RK, transcript variant K (SNF4Agamma), mRNA 
19.19   100  NM_169950.1  CG17299-RG, transcript variant G (SNF4Agamma), mRNA 
19.19   100  NM_001043271.1  CG17299-RL, transcript variant L (SNF4Agamma), mRNA 
9.98   52  NM_001043274.1  CG17299-RI, transcript variant I (SNF4Agamma), mRNA 
0   NM_143701.2  CG6698-RA (NtR), mRNA 
0   NM_167844.1  CG32479-RA (CG32479), mRNA 
0   NM_140263.1  CG14127-RA (CG14127), mRNA 
0   NM_079818.2  CG10002-RA (fkh), mRNA 
0   NM_165508.1  CG11084-RA, transcript variant A (pk), mRNA 
0   11  NM_206552.1  CG31140-RC, transcript variant C (CG31140), mRNA 
0   11  NM_206553.1  CG31140-RB, transcript variant B (CG31140), mRNA 
0   11  NM_142942.3  CG31140-RA, transcript variant A (CG31140), mRNA 
0   NM_168224.1  CG14837-RA, transcript variant A (CG14837), mRNA 
0   NM_139879.1  CG14837-RB, transcript variant B (CG14837), mRNA 
0   NM_169497.1  CG8476-RA (CG8476), mRNA 
0   NM_140238.1  CG14135-RA (CG14135), mRNA 
0   NM_165509.1  CG11084-RB, transcript variant B (pk), mRNA 
0   NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   NM_206768.1  CG9132-RA, transcript variant A (CG9132), mRNA 
0   NM_206767.1  CG9132-RB, transcript variant B (CG9132), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_001014503.1  CG8715-RD, transcript variant D (lig), mRNA 
0   NM_001042891.1  CG31761-RE, transcript variant E (bru-2), mRNA 
0   NM_142106.1  CG14843-RA (CG14843), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.