National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17271R-1 
 Symbol CG17271  Full Name CG17271 
 CG No CG17271  Old CG No CG17271 
 Synonyms CG17271 
 Accession No (Link to NCBI) NM_142659.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| silico     1   TGCTGCCCCTAATCCTGATTGGATTGGCCAGCGGACAGCGCGT-CGCTCCCGGAGTGAAT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCGCAGCACTATCAACAAGTGCCGCAGCAGGTGCCGCAGCACCACCCACCGCCACCACCG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAGCACCACCAGCCGCAGTACCAGCAACAGGTCCACTCAGCACCCGGTGTGCCGCCCCAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CAATACCAATACGAACAGGTTCAAGTTCCCGTGCAACAGCAGGCACCGGTCCAATATCAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAAGTTCCTGTGCAGCAGCAGCAGCAGCAACATCAACCAATCCACCAGCAACCGACGATG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAGCAACAGCAACAGCCGCAGCAGGGGCACCACCAGCAGGCAGGTGGCCACCACCATGGG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAACCGCAGCAAGTCCTAAACACCGGCAACATTCAGCAGGAGCGCGCTCACATCCAGGAG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CACATGCAAGTGCCAATCGATACGAGCAAGATGTCCGAGGCTGAGCTGCAGTTCCACTAC 480

17271R-1.IR_full       481 TTCAAGATGCACGACTCGGAC 501
                           ||||||||||||||||||||| silico     481 TTCAAGATGCACGACTCGGAC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.62  485  15  69  117  NM_142659.1  CG17271-RA, transcript variant A (CG17271), mRNA 
100   482  20  32  NM_001043269.1  CG17271-RB, transcript variant B (CG17271), mRNA 
10.58   51  242  770  1877  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
10.58   51  242  770  1877  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
10.58   51  242  770  1877  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
3.31   16  69  292  634  NM_168571.2  CG32133-RA (CG32133), mRNA 
2.48   12  59  236  591  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
2.48   12  59  236  591  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
2.48   12  59  236  591  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
2.48   12  34  97  237  NM_168461.2  CG11711-RA, transcript variant A (Mob1), mRNA 
2.28   11  105  356  885  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
2.28   11  105  356  885  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
2.28   11  71  251  564  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
2.28   11  66  203  462  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
2.28   11  39  246  563  NM_139493.2  CG2083-RA (CG2083), mRNA 
2.28   11  20  48  96  NM_135314.2  CG7105-RA (Proct), mRNA 
2.07   10  55  231  617  NM_079903.2  CG15319-RB (nej), mRNA 
2.07   10  41  137  439  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
2.07   10  41  137  439  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
2.07   10  34  190  481  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
2.07   10  33  114  264  NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
2.07   10  33  114  264  NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
2.07   10  32  94  266  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
2.07   10  32  94  262  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
2.07   10  28  92  198  NM_134890.2  CG17265-RA (CG17265), mRNA 
2.07   10  24  97  230  NM_001014631.1  CG31243-RH, transcript variant H (cpo), mRNA 
2.07   10  24  97  223  NM_001014632.1  CG31243-RG, transcript variant G (cpo), mRNA 
2.07   10  18  87  219  NM_143745.2  CG18389-RA (Eip93F), mRNA 
2.07   10  14  54  153  NM_001014736.1  CG1770-RC, transcript variant C (HDAC4), mRNA 
2.07   10  14  54  153  NM_167356.1  CG1770-RB, transcript variant B (HDAC4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.