National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17271R-1 
 Symbol CG17271  Full Name CG17271 
 CG No CG17271  Old CG No CG17271 
 Synonyms CG17271 
 Accession No (Link to NCBI) NM_142659.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| silico     1   TGCTGCCCCTAATCCTGATTGGATTGGCCAGCGGACAGCGCGT-CGCTCCCGGAGTGAAT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCGCAGCACTATCAACAAGTGCCGCAGCAGGTGCCGCAGCACCACCCACCGCCACCACCG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAGCACCACCAGCCGCAGTACCAGCAACAGGTCCACTCAGCACCCGGTGTGCCGCCCCAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CAATACCAATACGAACAGGTTCAAGTTCCCGTGCAACAGCAGGCACCGGTCCAATATCAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAAGTTCCTGTGCAGCAGCAGCAGCAGCAACATCAACCAATCCACCAGCAACCGACGATG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAGCAACAGCAACAGCCGCAGCAGGGGCACCACCAGCAGGCAGGTGGCCACCACCATGGG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAACCGCAGCAAGTCCTAAACACCGGCAACATTCAGCAGGAGCGCGCTCACATCCAGGAG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CACATGCAAGTGCCAATCGATACGAGCAAGATGTCCGAGGCTGAGCTGCAGTTCCACTAC 480

17271R-1.IR_full       481 TTCAAGATGCACGACTCGGAC 501
                           ||||||||||||||||||||| silico     481 TTCAAGATGCACGACTCGGAC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.62  485  15  69  117  NM_142659.1  CG17271-RA, transcript variant A (CG17271), mRNA 
100   482  20  32  NM_001043269.1  CG17271-RB, transcript variant B (CG17271), mRNA 
10.58   51  242  770  1877  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
10.58   51  242  770  1877  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
10.58   51  242  770  1877  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
3.31   16  69  292  634  NM_168571.2  CG32133-RA (CG32133), mRNA 
2.48   12  59  236  591  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
2.48   12  59  236  591  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
2.48   12  59  236  591  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
2.48   12  34  97  237  NM_168461.2  CG11711-RA, transcript variant A (Mob1), mRNA 
2.28   11  105  356  885  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
2.28   11  105  356  885  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
2.28   11  71  251  564  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
2.28   11  66  203  462  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
2.28   11  39  246  563  NM_139493.2  CG2083-RA (CG2083), mRNA 
2.28   11  20  48  96  NM_135314.2  CG7105-RA (Proct), mRNA 
2.07   10  55  231  617  NM_079903.2  CG15319-RB (nej), mRNA 
2.07   10  41  137  439  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
2.07   10  41  137  439  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
2.07   10  34  190  481  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
2.07   10  33  114  264  NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
2.07   10  33  114  264  NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
2.07   10  32  94  266  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
2.07   10  32  94  262  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
2.07   10  28  92  198  NM_134890.2  CG17265-RA (CG17265), mRNA 
2.07   10  24  97  230  NM_001014631.1  CG31243-RH, transcript variant H (cpo), mRNA 
2.07   10  24  97  223  NM_001014632.1  CG31243-RG, transcript variant G (cpo), mRNA 
2.07   10  18  87  219  NM_143745.2  CG18389-RA (Eip93F), mRNA 
2.07   10  14  54  153  NM_001014736.1  CG1770-RC, transcript variant C (HDAC4), mRNA 
2.07   10  14  54  153  NM_167356.1  CG1770-RB, transcript variant B (HDAC4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.