National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1725R-1 
 Symbol dlg1  Full Name discs large 1 
 CG No CG1725  Old CG No CG1725 
 Synonyms dlg, DLG, Dlg, Discs-large, Dlg-A, anon-EST:Posey93, Dlg1, dlg-A, misb, CG1725, DLG-A, DlgA, dlgA, dlg-1, Drodlg, l(1)dlg1, l(1)dlg, l(1)10Bf, l(1)d.lg-1, l(1)discs large, l(1)bwn, l(1)dlg-1, d. lg.-1, l(1)L11, 11, l(1)lpr-2, l(1)d.lg.-1, l(1)G0276, l(1)G0342, l(1)G0456, l(1)l.pr.-2, l(1)G19, CG1730, anon-WO03040301.258, anon-WO03040301.268, anon-WO03040301.260, dlg1, discs large 1, lethal(1)benign wing imaginal disc neoplasm, discs large, lethal(2)discs large, Discs large, lethal(1)discs-large, discs-large, Discs Large, Disc Large, lethal(1)discs large, discslarge, Discs-Large, Discslarge, disc-large 
 Accession No (Link to NCBI) NM_206683.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]

Wang Y, Antunes M, Anderson AE, Kadrmas JL, Jacinto A, Galko MJ.
Integrin Adhesions Suppress Syncytium Formation in the Drosophila Larval Epidermis.
Curr. Biol. (2015) 25(17) 2215-27 [ PubMed ID = 26255846 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Kim MJ, Choe KM.
Basement membrane and cell integrity of self-tissues in maintaining Drosophila immunological tolerance.
PLoS Genet. (2014) 10(10) e1004683 [ PubMed ID = 25329560 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTTTGCTACACACAAGACGA 
 Primer Seq. 3'
aatctagaggtaccCTACATCACTGAATCCACCGA 
 Predicted Fragment Size
475 
 IR fragment full Seq
0001 GCTTTGCTAC ACACAAGACG ATGCCAATGC TGAAGGAGCT TCCGAGGAGA ACGTGTTGTC 
0061 CTACGAGGCC GTACAGCGTT TGTCCATCAA CTACACGCGC CCGGTGATTA TTCTGGGACC 
0121 CCTGAAGGAT CGCATCAACG ATGACCTTAT ATCAGAGTAT CCCGACAAGT TCGGCTCCTG 
0181 TGTGCCACAC ACCACCCGAC CCAAGCGAGA GTACGAGGTG GATGGTAGGG ACTACCACTT 
0241 TGTATCCTCT CGCGAGCAAA TGGAACGGGA TATTCAGAAT CATCTGTTCA TCGAGGCGGG 
0301 ACAGTATAAC GACAATCTGT ACGGCACATC GGTGGCCAGC GTGCGCGAAG TGGCCGAGAA 
0361 GGGTAAACAC TGCATCCTGG ACGTGTCCGG GAACGCCATC AAGCGACTCC AAGTTGCCCA 
0421 GCTGTATCCC GTCGCCGTGT TCATCAAGCC CAAGTCGGTG GATTCAGTGA TGTAG 
 in silico PCR Fragment
0001 GCTTTGCTAC ACACAAGACG ATGCCAATGC TGAAGGAGCT TCCGAGGAGA ACGTGTTGTC 
0061 CTACGAGGCC GTACAGCGTT TGTCCATCAA CTACACGCGC CCGGTGATTA TTCTGGGACC 
0121 CCTGAAGGAT CGCATCAACG ATGACCTTAT ATCAGAGTAT CCCGACAAGT TCGGCTCTTG 
0181 TGTGCCACAC ACCACCCGAC CCAAGCGAGA GTACGAGGTG GATGGTAGGG ACTACCACTT 
0241 TGTATCCTCT CGCGAGCAAA TGGAACGGGA TATTCAGAAT CATCTGTTCA TCGAGGCGGG 
0301 ACAGTATAAC GACAATCTGT ACGGCACATC GGTGGCCAGC GTGCGCGAAG TGGCCGAGAA 
0361 GGGTAAACAC TGCATCCTGG ACGTGTCCGG GAACGCCATC AAGCGACTCC AAGTTGCCCA 
0421 GCTGTATCCC GTCGCCGTGT TCATCAAGCC CAAGTCGGTG GATTCAGTGA TGGAA 
 Assemble Data

1725R-1.IR_full       1   GCTTTGCTACACACAAGACGATGCCAATGCTGAAGGAGCTTCCGAGGAGAACGTGTTGTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1725R-1.in silico     1   GCTTTGCTACACACAAGACGATGCCAATGCTGAAGGAGCTTCCGAGGAGAACGTGTTGTC 60


1725R-1.IR_full       61  CTACGAGGCCGTACAGCGTTTGTCCATCAACTACACGCGCCCGGTGATTATTCTGGGACC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1725R-1.in silico     61  CTACGAGGCCGTACAGCGTTTGTCCATCAACTACACGCGCCCGGTGATTATTCTGGGACC 120


1725R-1.IR_full       121 CCTGAAGGATCGCATCAACGATGACCTTATATCAGAGTATCCCGACAAGTTCGGCTCCTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
1725R-1.in silico     121 CCTGAAGGATCGCATCAACGATGACCTTATATCAGAGTATCCCGACAAGTTCGGCTCTTG 180


1725R-1.IR_full       181 TGTGCCACACACCACCCGACCCAAGCGAGAGTACGAGGTGGATGGTAGGGACTACCACTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1725R-1.in silico     181 TGTGCCACACACCACCCGACCCAAGCGAGAGTACGAGGTGGATGGTAGGGACTACCACTT 240


1725R-1.IR_full       241 TGTATCCTCTCGCGAGCAAATGGAACGGGATATTCAGAATCATCTGTTCATCGAGGCGGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1725R-1.in silico     241 TGTATCCTCTCGCGAGCAAATGGAACGGGATATTCAGAATCATCTGTTCATCGAGGCGGG 300


1725R-1.IR_full       301 ACAGTATAACGACAATCTGTACGGCACATCGGTGGCCAGCGTGCGCGAAGTGGCCGAGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1725R-1.in silico     301 ACAGTATAACGACAATCTGTACGGCACATCGGTGGCCAGCGTGCGCGAAGTGGCCGAGAA 360


1725R-1.IR_full       361 GGGTAAACACTGCATCCTGGACGTGTCCGGGAACGCCATCAAGCGACTCCAAGTTGCCCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1725R-1.in silico     361 GGGTAAACACTGCATCCTGGACGTGTCCGGGAACGCCATCAAGCGACTCCAAGTTGCCCA 420


1725R-1.IR_full       421 GCTGTATCCCGTCGCCGTGTTCATCAAGCCCAAGTCGGTGGATTCAGTGATGTAG 475
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| | 
1725R-1.in silico     421 GCTGTATCCCGTCGCCGTGTTCATCAAGCCCAAGTCGGTGGATTCAGTGATGGAA 475

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   457  NM_206683.2  CG1725-RB, transcript variant B (dlg1), mRNA 
100   457  NM_206681.2  CG1725-RH, transcript variant H (dlg1), mRNA 
100   457  NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
91.68   419  NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
91.68   419  NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
91.68   419  NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 
4.37   20  NM_167281.1  CG1725-RF, transcript variant F (dlg1), mRNA 
0.21   NM_132500.2  CG11699-RA (CG11699), mRNA 
0   NM_140686.3  CG3764-RA (CG3764), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_135328.1  CG7219-RA (CG7219), mRNA 
0   NM_135812.2  CG16954-RA, transcript variant A (Hsp60D), mRNA 
0   NM_165043.1  CG16954-RB, transcript variant B (Hsp60D), mRNA 
0   NM_135117.1  CG11034-RA (CG11034), mRNA 
0   NM_167965.1  CG32296-RA (Mrtf), mRNA 
0   NM_139388.1  CG13930-RA (CG13930), mRNA 
0   NM_134726.2  CG4715-RA (Iris), mRNA 
0   NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
0   NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
0   NM_206341.1  CG6024-RB, transcript variant B (CG6024), mRNA 
0   NM_140246.1  CG6024-RA, transcript variant A (CG6024), mRNA 
0   NM_139893.2  CG7457-RA (CG7457), mRNA 
0   NM_132703.2  CG32626-RC, transcript variant C (CG32626), mRNA 
0   NM_167384.1  CG32626-RA, transcript variant A (CG32626), mRNA 
0   NM_167385.1  CG32626-RB, transcript variant B (CG32626), mRNA 
0   NM_167386.1  CG32626-RD, transcript variant D (CG32626), mRNA 
0   NM_165257.1  CG31790-RA (CG31790), mRNA 
0   NM_167641.1  CG14195-RA (CG14195), mRNA 
0   NM_138107.2  CG4781-RA (CG4781), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.