National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17223R-2 
 Symbol alpha4GT1  Full Name alpha4GT1 
 CG No CG17223  Old CG No CG17223 
 Synonyms CG17223, alpha4GT1 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCTCCTCTGGTTGCCCATT 
 Primer Seq. 3'
aatctagaggtaccAGCCACTCCTCCATGGGCGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

17223R-2.IR full       1   ATGCTCCTCTGGTTGCCCATTGCGGTGG-ACGCAGGATGTTCATCATCCTCGTCCTAATG 60
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
17223R-2.in silico     1   ATGCTCCTCTGGTTGCCCATTGCGGTGGCACGCAGGATGTTCATCATCCTCGTCCTAATG 60


17223R-2.IR full       61  GTAATTGGAGGCCTCTTCTACATCTACACTTCGGAAAATAAATACCACTCATGCTTTATG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17223R-2.in silico     61  GTAATTGGAGGCCTCTTCTACATCTACACTTCGGAAAATAAATACCACTCATGCTTTATG 120


17223R-2.IR full       121 GAGGGCCAAGTACTGGCAACTCAGCAGGCGCTAACTGCAGATGGCGAAACAAATCTATTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17223R-2.in silico     121 GAGGGCCAAGTACTGGCAACTCAGCAGGCGCTAACTGCAGATGGCGAAACAAATCTATTG 180


17223R-2.IR full       181 GGCGACGTCCTCCAGGCGGATCCCAAACCCTCGCCCGGAAACAGTATCTTCTTTCACGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17223R-2.in silico     181 GGCGACGTCCTCCAGGCGGATCCCAAACCCTCGCCCGGAAACAGTATCTTCTTTCACGAG 240


17223R-2.IR full       241 ACCAGCTGCCGCCTATCCGAGAACAGACAGCTGGAGACGCTGAAGGTCACTGCCCGCCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17223R-2.in silico     241 ACCAGCTGCCGCCTATCCGAGAACAGACAGCTGGAGACGCTGAAGGTCACTGCCCGCCAG 300


17223R-2.IR full       301 GCATGCGCAATCGAGTCGGCAGCGATGCATAATCCGAATTTCCAAGTGTTCGTCCTGTTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17223R-2.in silico     301 GCATGCGCAATCGAGTCGGCAGCGATGCATAATCCGAATTTCCAAGTGTTCGTCCTGTTC 360


17223R-2.IR full       361 GCTGGCCCCACCTATCGAATCTCCAACAACAATAGCCATCCCCAACCATTGGTGGAGGCC 420
                           |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||
17223R-2.in silico     361 GCTGGCCCCACCTATCGAATCTCCAACAACAAAAGCCATCCCCAACCATTGTTGGAGGCC 420


17223R-2.IR full       421 ATTCTTAGTTACAGCAATGTCCATCTACGTCGACTGAATCTCGAGAGTTACGCATCTGGC 480
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
17223R-2.in silico     421 ATTCTCAGTTACAGCAATGTCCATCTACGTCGACTGAATCTCGAGAGTTACGCATCTGGC 480


17223R-2.IR full       481 ACGCCCATGGAGGAGTGGCT 500
                           ||||||||||||||||||||
17223R-2.in silico     481 ACGCCCATGGAGGAGTGGCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_134893.2  alpha4GT1 CG17223-RA (alpha4GT1), mRNA 
NM_132852.1  CG8565-RA (CG8565), mRNA 
NM_130730.1  CG2941-RA (CG2941), mRNA 
NM_141825.1  CG14708-RA (CG14708), mRNA 
NM_176682.1  CG2930-RD, transcript variant D (CG2930), mRNA 
NM_135643.2  CG6192-RA (CG6192), mRNA 
NM_079569.3  Calreticulin CG9429-RA (Crc), mRNA 
NM_136014.1  CG5681-RA (CG5681), mRNA 
NM_080025.1  cut CG11387-RA, transcript variant A (ct), mRNA 
NM_166137.1  CG8405-RA (CG8405), mRNA 
NM_167130.1  cut CG11387-RB, transcript variant B (ct), mRNA 
NM_134627.1  CG17601-RA (CG17601), mRNA 
NM_167956.1  daughter of sevenless CG1044-RB, transcript variant B (dos), mRNA 
NM_079166.2  daughter of sevenless CG1044-RA, transcript variant A (dos), mRNA 
NM_130498.1  CG13362-RA (CG13362), mRNA 
NM_140713.1  CG16793-RA (CG16793), mRNA 
NM_136547.1  CG14748-RA (CG14748), mRNA 
NM_206578.1  CG33346-RA (CG33346), mRNA 
NM_168011.1  CG14968-RA, transcript variant A (CG14968), mRNA 
NM_168013.1  CG14968-RD, transcript variant D (CG14968), mRNA 
NM_168014.1  CG14968-RE, transcript variant E (CG14968), mRNA 
NM_168012.1  CG14968-RC, transcript variant C (CG14968), mRNA 
NM_139543.2  CG14968-RB, transcript variant B (CG14968), mRNA 
NM_057972.3  Origin recognition complex subunit 4 CG2917-RA (Orc4), mRNA 
NM_167570.1  lethal (1) G0222 CG8465-RC, transcript variant C (l(1)G0222), mRNA 
NM_132993.2  lethal (1) G0222 CG8465-RA, transcript variant A (l(1)G0222), mRNA 
NM_167569.1  lethal (1) G0222 CG8465-RB, transcript variant B (l(1)G0222), mRNA 
NM_167623.1  UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 CG6394-RB, transcript variant B (GalNAc-T2), mRNA 
11  NM_134544.1  HERC2 CG11734-RB (HERC2), mRNA 
NM_166198.1  Dek CG5935-RC, transcript variant C (Dek), mRNA 
NM_001042974.1  CG40130-RA (CG40130), mRNA 
10  NM_057638.3  purity of essence CG14472-RA (poe), mRNA 
NM_166137.1  CG8405-RA (CG8405), mRNA 
NM_001038866.1  CG33981-RB, transcript variant B (CG33981), mRNA 
NM_137425.3  CG6355-RA, transcript variant A (CG6355), mRNA 
NM_206158.1  CG6355-RB, transcript variant B (CG6355), mRNA 
NM_001038865.1  CG33981-RA, transcript variant A (CG33981), mRNA 
NM_130731.2  Vap-33-1 CG5014-RB, transcript variant B (Vap-33-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.