National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17221R-1 
 Symbol CG17221  Full Name CG17221 
 CG No CG17221  Old CG No CG17221 
 Synonyms DM_7295851, CG17221 
 Accession No (Link to NCBI) NM_134902.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAGGCCACCATTGGCTCGCA 
 Primer Seq. 3'
aatctagaggtaccTGTCGATGTTGGCCAGCAACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAGGCCACC ATTGGCTCGC ATGCGGAGTA TGTAGCCGTT CCTTCATACT GTCTTGCTCC 
0061 TGCACCCAAA GAACTGGATG ATTACGAGGC CGCCAGCGTG TTGTATGCCG GATTGACGGC 
0121 TTGGTCGGGA CTGTACATAA CTGGAGGCCT GGGTGGTCCA TGTGGAGCCA CAACAGCTTC 
0181 CGGTGGAGGT GCCCACAAGC GGGTCCTAGT CCTTGGCGGC TCCGGTGGCG TTGGCACATT 
0241 GGCCATACAA ATCCTCAAGT CCCAGAAAGT ACAAGTTTTG GCAACCTGCA GCGAAAATGC 
0301 CATTGAAATG GTTCGCAATT TGGGAGCCGA TTTAGTGGTC GACTATAACA ACCCGCAGGC 
0361 CATGGAGNGA GCTGTGCAAA TACGCACCCT ATGACATTGT GCTGGACTGC GCTGGACAAG 
0421 GTGGTCAGAA GGCGGCGGAA TCGAAGTACG GACTTTCGCC AGTACATCAC CTTCTCATCT 
0481 CCGTTGCTGG CCAACATCGA CA 
 in silico PCR Fragment
0001 ACAGGCCACC ATTGGCTCGC ATGCGGAGTA TGTAGCCGTT CCTTCATACT GTCTTGCTCC 
0061 TGCACCCAAA GAACTGGATG ATTACGAGGC CGCCAGCGTG TTGTATGCCG GATTGACGGC 
0121 TTGGTCGGGA CTGTACATAA CTGGAGGCCT GGGTGGTCCA TGTGGAGCCA CAACAGCTTC 
0181 CGGTGGAGGT GCCCACAAGC GGGTCCTAGT CCTTGGCGGC TCCGGTGGCG TTGGCACATT 
0241 GGCCATACAA ATCCTCAAGT CCCAGAAAGT ACAAGTTTTG GCAACCTGCA GCGAAAATGC 
0301 CATTGAAATG GTTCGCAATT TGGGAGCCGA TTTAGTGGTC GACTATAACA ACCCGCAGGC 
0361 CATGGAG-GA GCTGTGCAAA TACGCACCCT ATGACATTGT GCTGGACTGC GCTGGACAAG 
0421 GTGGTCAGAA GGCGGCGGAA TCGAAGTAC- GACTTTCGCC AGTACATCAC CTTCTCATCT 
0481 CCGTTGCTGG CCAACATCGA CA 
 Assemble Data

17221R-1.IR_full       1   ACAGGCCACCATTGGCTCGCATGCGGAGTATGTAGCCGTTCCTTCATACTGTCTTGCTCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17221R-1.in silico     1   ACAGGCCACCATTGGCTCGCATGCGGAGTATGTAGCCGTTCCTTCATACTGTCTTGCTCC 60


17221R-1.IR_full       61  TGCACCCAAAGAACTGGATGATTACGAGGCCGCCAGCGTGTTGTATGCCGGATTGACGGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17221R-1.in silico     61  TGCACCCAAAGAACTGGATGATTACGAGGCCGCCAGCGTGTTGTATGCCGGATTGACGGC 120


17221R-1.IR_full       121 TTGGTCGGGACTGTACATAACTGGAGGCCTGGGTGGTCCATGTGGAGCCACAACAGCTTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17221R-1.in silico     121 TTGGTCGGGACTGTACATAACTGGAGGCCTGGGTGGTCCATGTGGAGCCACAACAGCTTC 180


17221R-1.IR_full       181 CGGTGGAGGTGCCCACAAGCGGGTCCTAGTCCTTGGCGGCTCCGGTGGCGTTGGCACATT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17221R-1.in silico     181 CGGTGGAGGTGCCCACAAGCGGGTCCTAGTCCTTGGCGGCTCCGGTGGCGTTGGCACATT 240


17221R-1.IR_full       241 GGCCATACAAATCCTCAAGTCCCAGAAAGTACAAGTTTTGGCAACCTGCAGCGAAAATGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17221R-1.in silico     241 GGCCATACAAATCCTCAAGTCCCAGAAAGTACAAGTTTTGGCAACCTGCAGCGAAAATGC 300


17221R-1.IR_full       301 CATTGAAATGGTTCGCAATTTGGGAGCCGATTTAGTGGTCGACTATAACAACCCGCAGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17221R-1.in silico     301 CATTGAAATGGTTCGCAATTTGGGAGCCGATTTAGTGGTCGACTATAACAACCCGCAGGC 360


17221R-1.IR_full       361 CATGGAGNGAGCTGTGCAAATACGCACCCTATGACATTGTGCTGGACTGCGCTGGACAAG 420
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
17221R-1.in silico     361 CATGGAG-GAGCTGTGCAAATACGCACCCTATGACATTGTGCTGGACTGCGCTGGACAAG 420


17221R-1.IR_full       421 GTGGTCAGAAGGCGGCGGAATCGAAGTACGGACTTTCGCCAGTACATCACCTTCTCATCT 480
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
17221R-1.in silico     421 GTGGTCAGAAGGCGGCGGAATCGAAGTAC-GACTTTCGCCAGTACATCACCTTCTCATCT 480


17221R-1.IR_full       481 CCGTTGCTGGCCAACATCGACA 502
                           ||||||||||||||||||||||
17221R-1.in silico     481 CCGTTGCTGGCCAACATCGACA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164523.1  CG17221-RB, transcript variant B (CG17221), mRNA 
100   482  NM_134902.1  CG17221-RA, transcript variant A (CG17221), mRNA 
0.41   NM_080369.2  CG12055-RA, transcript variant A (Gapdh1), mRNA 
0.41   NM_001038847.1  CG12055-RB, transcript variant B (Gapdh1), mRNA 
0   NM_168908.1  CG7199-RC, transcript variant C (Hr78), mRNA 
0   NM_168907.1  CG7199-RB, transcript variant B (Hr78), mRNA 
0   NM_079479.3  CG7199-RA, transcript variant A (Hr78), mRNA 
0   NM_206415.1  CG7199-RD, transcript variant D (Hr78), mRNA 
0   NM_169963.1  CG31176-RA (CG31176), mRNA 
0   NM_168928.1  CG11307-RB, transcript variant B (CG11307), mRNA 
0   NM_141081.1  CG11307-RA, transcript variant A (CG11307), mRNA 
0   NM_141475.2  CG3027-RA (pyd3), mRNA 
0   NM_132844.2  CG8952-RA (CG8952), mRNA 
0   NM_132811.2  CG7860-RA (CG7860), mRNA 
0   NM_168456.1  CG7557-RB, transcript variant B (CG7557), mRNA 
0   NM_140207.2  CG7557-RA, transcript variant A (CG7557), mRNA 
0   NM_138180.1  CG13881-RA (CG13881), mRNA 
0   NM_140136.1  CG12303-RA (CG12303), mRNA 
0   NM_080062.1  CG8953-RA (Actn3), mRNA 
0   NM_140429.3  CG6661-RA (CG6661), mRNA 
0   NR_002486.1  CG6661-RA (CG6661), mRNA, miscRNA 
0   NM_135281.1  CG6630-RA (CG6630), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_137942.1  CG13550-RA (CG13550), mRNA 
0   NM_138263.1  CG9169-RA (FucTD), mRNA 
0   12  NM_133112.1  CG7349-RA (CG7349), mRNA 
0   NM_165877.1  CG30203-RA (CG30203), mRNA 
0   NM_143768.2  CG12286-RA (kar), mRNA 
0   NM_206660.1  CG11265-RB, transcript variant B (CG11265), mRNA 
0   NM_136637.1  CG13954-RA (CG13954), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.